UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001650
NM_004028
XM_005258257
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001650 [Chr.18(-): 24432007-24445716 GRCh37]
Id:Exon_5_1
Position:Chr.18(-): 24435991-24436621 GRCh37
Chr.18(-): 22689989-22690619 NCBI36
Sequence:
TCTGATGAGGCTTTGGTGTGTTTTCTTATTTCCTCTCCAATTCCCCTCTTTTTGATGCATGACACAAATACACTCTTAAT
TTAACCCAGCTAGATTCTACATTCATGAGCTGCTCAATGGAATAGCTTTTCTCTACTTACACTCTATCCTCTTCCATCTT
TTCCTTAGATATATTGGGTTGGGCCCATCATAGGAGCTGTCCTCGCTGGTGGCCTTTATGAGTATGTCTTCTGTCCAGAT
GTTGAATTCAAACGTCGTTTTAAAGAAGCCTTCAGCAAAGCTGCCCAGCAAAC
AAAAGGAAGCTACATGGAGGTGGAGGA
CAACAGGAGTCAGGTAGAGACGGATGACCTGATTCTAAAACCTGGAGTGGTGCATGTGATTGACGTTGACCGGGGAGAGG
AGAAGAAGGGGAAAGACCAATCTGGAGAGGTATTGTCTTCAGTATGA
CTAGAAGATCGCACTGAAAGCAGACAAGACTCC
TTAGAACTGTCCTCAGATTTCCTTCCACCCATTAAGGAAACAGATTTGTTATAAATTAGAAATGTGCAGGTTTGTTGTTT
CATGTCATATTACTCAGTCTAAACAATAAATATTTCATAATTTACAAA
GGAGGAACGGAAGAAACCTATTG
Color Legend: SNP  UTR  CODING
Sample Sets: D76SampleSet
Assays: AQP4-5_1
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
3145
PDE
24436519 GRCh37
22690517 NCBI36
  
AATTTAACCCAGCTAGATTCTACAT T → C CATGAGCTGCTCAATGGAATAGCTT
- 
 
n=
T/T=
T/C=
C/C=
C=
94
37
10
0
0.106
76
24
11
3
0.224
92
18
17
11
0.424
84
18
16
8
0.381
D76SampleSet
 
3146
PDE
24436504 GRCh37
22690502 NCBI36
  
GATTCTACATTCATGAGCTGCTCAA T → A GGAATAGCTTTTCTCTACTTACACT
- 
 
n=
T/T=
T/A=
A/A=
A=
94
46
1
0
0.011
76
38
0
0
0.000
92
46
0
0
0.000
84
42
0
0
0.000
D76SampleSet
Exon 5: Coding
3147
PDE
24436328 GRCh37
22690326 NCBI36
882819
CCTTCAGCAAAGCTGCCCAGCAAAC A → G AAAGGAAGCTACATGGAGGTGGAGG
-273
Thr = Thr
n=
A/A=
A/G=
G/G=
G=
94
46
1
0
0.011
76
38
0
0
0.000
92
46
0
0
0.000
84
42
0
0
0.000
D76SampleSet

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.