UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001650
NM_004028
XM_005258257
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001650 [Chr.18(-): 24432007-24445716 GRCh37]
Id:Exon_5_2
Position:Chr.18(-): 24435664-24436256 GRCh37
Chr.18(-): 22689662-22690254 NCBI36
Sequence:
AGTGGTGCATGTGATTGACGTTGACCGGGGAGAGGAGAAGAAGGGGAAAGACCAATCTGGAGAGGTATTGTCTTCAGTAT
GA
CTAGAAGATCGCACTGAAAGCAGACAAGACTCCTTAGAACTGTCCTCAGATTTCCTTCCACCCATTAAGGAAACAGAT
TTGTTATAAATTAGAAATGTGCAGGTTTGTTGTTTCATGTCATATTACTCAGTCTAAACAATAAATATTTCATAATTTAC
AAAGGAGGAACGGAAGAAACCTATTGTGAATTCCAAATCTAAAAAAAGAAATATTTTTAAA
ATGTTCTTAAGCAAATATA
TACCTA
TTTTATCTAGTTACCTTTCATTAACAACCAATTTTAACCGTGTGTCAAGATTTGGTTAAGTCTTGCCTGACAGA
ACTCAAAGACACGTCTATCAGCTTATTCCTTCTCTACT
GGAATATTGGTATAGTCAATTCTTATTTGAATATTTATTCTA
TTAAACTGAGTTTAACAATGGCAAAATACAGTATGTCACAGTCATGCACATTCAAGAGAGAAAATATAACAAGTTCTTTT
ATGAGCAAT
CCCTTATGCATAGACTACCTTGGC
Color Legend: SNP  UTR  CODING
Sample Sets: D76SampleSet
Assays: AQP4-5_2
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 5: 3UTR
3148
PDE
24435955 GRCh37
22689953 NCBI36
1255 
ATCTAAAAAAAGAAATATTTTTAAA A → C TGTTCTTAAGCAAATATATACCTAT
- 
 
n=
A/A=
A/C=
C/C=
C=
92
46
0
0
0.000
82
40
0
1
0.024
94
47
0
0
0.000
94
47
0
0
0.000
D76SampleSet
Exon 5: 3UTR
3149
PDE
24435930 GRCh37
22689928 NCBI36
1280 
ATGTTCTTAAGCAAATATATACCTA T → C TTTATCTAGTTACCTTTCATTAACA
- 
 
n=
T/T=
T/C=
C/C=
C=
92
42
4
0
0.043
82
41
0
0
0.000
94
47
0
0
0.000
94
47
0
0
0.000
D76SampleSet
Exon 5: 3UTR
3150
PDE
24435892 GRCh37
22689890 NCBI36
1318 
CCTTTCATTAACAACCAATTTTAAC C → T GTGTGTCAAGATTTGGTTAAGTCTT
- 
 
n=
C/C=
C/T=
T/T=
T=
92
30
14
2
0.196
82
41
0
0
0.000
94
47
0
0
0.000
94
47
0
0
0.000
D76SampleSet
Exon 5: 3UTR
3151
PDE
24435871 GRCh37
22689869 NCBI36
1339 
TAACCGTGTGTCAAGATTTGGTTAA G → C TCTTGCCTGACAGAACTCAAAGACA
- 
 
n=
G/G=
G/C=
C/C=
C=
92
44
2
0
0.022
82
41
0
0
0.000
94
47
0
0
0.000
94
46
1
0
0.011
D76SampleSet
Exon 5: 3UTR
3152
PDE
4 pubsI
24435818 GRCh37
22689816 NCBI36
1392 
TCTATCAGCTTATTCCTTCTCTACT G → A GAATATTGGTATAGTCAATTCTTAT
- 
 
n=
G/G=
G/A=
A/A=
A=
92
27
16
3
0.239
82
23
10
8
0.317
94
18
19
10
0.415
94
15
20
12
0.468
D76SampleSet

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.