UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_003051
NM_001166496
XM_005271150
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_003051 [Chr.1(-): 113454469-113498975 GRCh37]
Id:SLC16A1-P SEQ
Position:Chr.1(-): 113498750-113499285 GRCh37
Chr.1(-): 113300273-113300808 NCBI36
Sequence:
CATCCATTCAAATGCTGCCCATTCCCCGCTCCTCAGTCGCTTCCCGCTACTCCGCACGCGCATCTCCCCCACCCGTCAGG
GTCAGGCCTCTCGGTGACTTTTCCTTTTTCTCTGGCAGAAACTGAGGGGTGAGACCGATGGTTGTGTCCCGAACGAGGGC
AGATTGCCTAGAGCTCGTCAGACAGGGACCCAAGGGCGAGTCTGGCAGGGCGTGGTAGCTCCGCGCCGCTCAGCAGGGGC
GCAGCGCGCGGGTCGGACTGGGACGCCGGTCACGTGGCGGGGAGGGGGCGCCGGCGCGCGCGGGCGAGCTAGAGGGCGCG
CGCGGCTGAAAGCGTGTGGAGGCGCGGGCTGCAGTTCGGATGTCTGTGTGGCGGGGAGGGGGCGGCGG
CCGGGAGAGACG
ACTCCGCCCCCTG
CGCGCATGCTCCGGCCCCGGCGGGTTATAAGGCAGCCTCGCTGGCCCGGCCAGACAAAGTGGTGAGC
TGCGACGTGACTGGCTAGCTGCGTGGGTACTGGA
ACAAGCAAACGAGGCAGCGAGC
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: SLC16A1-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Promoter
3057
PDE
113499150 GRCh37
113300673 NCBI36
-175-27220
TCTGGCAGAAACTGAGGGGTGAGAC C → T GATGGTTGTGTCCCGAACGAGGGCA
- 
 
n=
C/C=
C/T=
T/T=
T=
126
62
1
0
0.008
132
66
0
0
0.000
128
64
0
0
0.000
128
63
1
0
0.008
PMT-272
Promoter
3058
PDE
113499092 GRCh37
113300615 NCBI36
-117-27162
TAGAGCTCGTCAGACAGGGACCCAA G → A GGCGAGTCTGGCAGGGCGTGGTAGC
- 
 
n=
G/G=
G/A=
A/A=
A=
126
63
0
0
0.000
132
65
1
0
0.008
128
64
0
0
0.000
128
63
1
0
0.008
PMT-272
Promoter
3059
PDE
113499088 GRCh37
113300611 NCBI36
-113-27158
GCTCGTCAGACAGGGACCCAAGGGC G → A AGTCTGGCAGGGCGTGGTAGCTCCG
- 
 
n=
G/G=
G/A=
A/A=
A=
126
62
1
0
0.008
132
66
0
0
0.000
128
64
0
0
0.000
128
64
0
0
0.000
PMT-272
Promoter
3060
PDE
1 pub
113499075 GRCh37
113300598 NCBI36
-100-27145
GGACCCAAGGGCGAGTCTGGCAGGG C → G GTGGTAGCTCCGCGCCGCTCAGCAG
- 
 
n=
C/C=
C/G=
G/G=
G=
126
63
0
0
0.000
132
66
0
0
0.000
128
52
12
0
0.094
128
64
0
0
0.000
PMT-272
Promoter
3061
113498977 GRCh37
113300500 NCBI36
-2-27047
GGGGGCGCCGGCGCGCGCGGGCGAG CT → - AGAGGGCGCGCGCGGCTGAAAGCG
- 
 
n=
CT/CT=
CT/-=
-/-=
-=
126
62
1
0
0.008
132
66
0
0
0.000
128
64
0
0
0.000
128
64
0
0
0.000
PMT-272
Exon 1: 5UTR
3180
113498897 GRCh37
113300420 NCBI36
79-26967
CTGTGTGGCGGGGAGGGGGCGGCGG C → CGGCGGC CGGGAGAGACGACTCCGCCCCCTGC
- 
 
n=
C/C=
C/CGGCGGC=
CGGCGGC/CGGCGGC=
CGGCGGC=
124
51
11
0
0.089
132
66
0
0
0.000
128
64
0
0
0.000
128
62
2
0
0.016
PMT-272
Exon 1: 5UTR
3063
PDE
113498872 GRCh37
113300395 NCBI36
104-26942
CCGGGAGAGACGACTCCGCCCCCTG C → A GCGCATGCTCCGGCCCCGGCGGGTT
- 
 
n=
C/C=
C/A=
A/A=
A=
102
50
1
0
0.010
132
66
0
0
0.000
128
64
0
0
0.000
124
62
0
0
0.000
PMT-272
Exon 1: 5UTR
3064
PDE
113498861 GRCh37
113300384 NCBI36
115-26931
GACTCCGCCCCCTGCGCGCATGCTC C → G GGCCCCGGCGGGTTATAAGGCAGCC
- 
 
n=
C/C=
C/G=
G/G=
G=
102
48
3
0
0.029
132
66
0
0
0.000
128
64
0
0
0.000
124
61
1
0
0.008
PMT-272
Exon 1: 5UTR
3181
113498855 GRCh37
113300378 NCBI36
121-26925
GCCCCCTGCGCGCATGCTCCGGCCC C → CC GGCGGGTTATAAGGCAGCCTCGCTG
- 
 
n=
C/C=
C/CC=
CC/CC=
CC=
102
50
1
0
0.010
132
66
0
0
0.000
128
64
0
0
0.000
124
62
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.