UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004790
NM_153276
NM_153277
NM_153278
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004790 [Chr.11(-): 62744069-62752495 GRCh37]
Id:SLC22A6-P SEQ
Position:Chr.11(-): 62752293-62753142 GRCh37
Chr.11(-): 62508869-62509718 NCBI36
Sequence:
TAAGGGAAAAATCTGACCCTTGGAAGGGTCAGAAGAATCACTGGAAGAATCACCCGACATTGTGTATGACGTTGGTCTTA
GGTCCCACTCCAAGAGCGGCCTCTGACTTCTGTTGTTTCTTCCAAATGAATAAAACCATGGTTCTATAAGATGTGAGCTG
TCCCCAGAAGAACAAAGACTGGGGTTGTCACATTTAGCAAATAAAGATACAGGGTGCCCAGTCAAATTTGCATTTCAAAT
CAATGAAGAATTGCTTAGTATAAGTATGTCTCATGCAATATTAGAGACATACTCATACTTTTAAAAACTCTTCATTGACC
TAAAATGCAAATTTGACTGGGCACCCTGTAATTTCCCTGGCAACCCTTCCCAAAAGCAGACTATTTGGATCTCATCCACT
AAAAAGGGCAGAAACTCCTCAAGAGGCCACCACACTTCCCAGAGCCCAGTCTCCTTCCTAAAAGGAAGACAAATAGGTCC
AATAGATCCCACTCTGGCCCCCCCTGCCCCCAGATGCCCCCCTAATACACCCCTCTCCCTGCTCCTATTCAGTCCACCCT
CTCCTGCCCTTTATAACCACTTGGAGAAATTCCACTGACACAAGGAATCCTTGGAGGGTTAATCCTTCTGATACCAAGTC
ACACTTTAACTCATTCCCTCCAGGCCAAGGATTAAAAACTGCCCATGCAAGGGTCAGGTCTCCAGCAGACCCTGAAAGCT
GAGCTGCCCTGACCCCCAAAGTGAGGAGAAGCTGCAAGGGAAAAGGGAGGGACAGATCAGGGAGACCGGGGAAGAAGGAG
GAGCAGCCAAGGAGGCTGCTGTCCCCC
CACAGAGCAGCTCGGACTCAGCT
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: SLC22A6-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Promoter
3170
PDE
62752640 GRCh37
62509216 NCBI36
-145-478
TCCAATAGATCCCACTCTGGCCCCC C → G CTGCCCCCAGATGCCCCCCTAATAC
- 
 
n=
C/C=
C/G=
G/G=
G=
134
65
2
0
0.015
128
53
11
0
0.086
136
68
0
0
0.000
126
58
5
0
0.040
PMT-272
Promoter
3171
PDE
62752587 GRCh37
62509163 NCBI36
-92-425
CCCTCTCCCTGCTCCTATTCAGTCC A → G CCCTCTCCTGCCCTTTATAACCACT
- 
 
n=
A/A=
A/G=
G/G=
G=
134
65
2
0
0.015
128
53
11
0
0.086
136
68
0
0
0.000
126
58
4
1
0.048
PMT-272
Exon 1: 5UTR
Promoter
3172
PDE
62752457 GRCh37
62509033 NCBI36
39-295
CAGGCCAAGGATTAAAAACTGCCCA T → C GCAAGGGTCAGGTCTCCAGCAGACC
- 
 
n=
T/T=
T/C=
C/C=
C=
134
67
0
0
0.000
128
64
0
0
0.000
136
68
0
0
0.000
126
62
1
0
0.008
PMT-272
Exon 1: 5UTR
3173
PDE
62752440 GRCh37
62509016 NCBI36
56-278
ACTGCCCATGCAAGGGTCAGGTCTC C → T AGCAGACCCTGAAAGCTGAGCTGCC
- 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
128
63
1
0
0.008
136
68
0
0
0.000
126
62
1
0
0.008
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.