UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001650
NM_004028
XM_005258257
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001650 [Chr.18(-): 24432007-24445716 GRCh37]
Id:Exon_2
Position:Chr.18(-): 24441984-24442687 GRCh37
Chr.18(-): 22695982-22696685 NCBI36
Sequence:
TTGGTGTGCAAATCACGCCTGGCAGCCCCTGCCCACAGTACCCGAAGATGGCAGGCCTTGTTCCCTTCACCTAAATTCAT
AAACCTGGGTGTAGTGGCTTCTGATGCTGATTTGTTTCTCTTTTCAGTAAGTGTGGACCTTTGTGTACCAGAGAGAACAT
CATGGTGGCTTTCAAAGGGGTCTGGACTCAAGCTTTCTGGAAAGCAGTCACAGCGGAATTTCTGGCCATGCTTATTTTTG
TTCTCCTCAGCCTGGGATCCACCATCAACTGGGGTGGAACAGAAAAGCCTTTACC
GGTCGACATGGTTCTCATCTCCCTT
TGCTTTGGACTCAGCATTGCAACCATGGTGCAGTGCTTTGGCCATATCAGCGGTGGCCACATCAACCCTGCAGTGACTGT
GGCCATGGTGTGCACCAGGAAGATCAGCATCGCCAAGTCTGTCTTCTACATCGCAGCCCA
GTGCCTGGGGGCCATCATTG
GAGCAGGAATCCTCTATCTGGTCACACCTCCCAGTGTGGTGGGAGGCCTGGGAGTCACCATG
GTAGCATCTTTAGCTATT
TTCAAACTAGGACTCCAAGCTTCTTGCAAACTCTTTGCTAAATAATGCCTTGGTGGCATGAGGCACATCCCTAAAATAGC
TAATTTACTCCTAGGGAATTTTTGATGATTCTTAATAGTGTGAAAACTGATTCTGGCAGTATTT
Color Legend: SNP  UTR  CODING
Sample Sets: D76SampleSet
Assays: AQP4-2
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
3216
PDE
24442580 GRCh37
22696578 NCBI36
  
ACCTGGGTGTAGTGGCTTCTGATGC T → C GATTTGTTTCTCTTTTCAGTAAGTG
- 
 
n=
T/T=
T/C=
C/C=
C=
94
46
1
0
0.011
74
37
0
0
0.000
94
47
0
0
0.000
86
43
0
0
0.000
D76SampleSet
Exon 2: Coding
3217
PDE
24442392 GRCh37
22696390 NCBI36
264201
GGGGTGGAACAGAAAAGCCTTTACC G → T GTCGACATGGTTCTCATCTCCCTTT
-67
Pro = Pro
n=
G/G=
G/T=
T/T=
T=
94
45
2
0
0.021
74
27
9
1
0.149
94
47
0
0
0.000
86
40
3
0
0.035
D76SampleSet
Exon 2: Coding
3218
PDE
1 pub
24442227 GRCh37
22696225 NCBI36
429366
AGTCTGTCTTCTACATCGCAGCCCA G → A TGCCTGGGGGCCATCATTGGAGCAG
-122
Gln = Gln
n=
G/G=
G/A=
A/A=
A=
94
45
2
0
0.021
74
33
4
0
0.054
94
47
0
0
0.000
86
42
1
0
0.012
D76SampleSet
Exon 2: Coding
3219
PDE
1 pub
24442210 GRCh37
22696208 NCBI36
446383
GCAGCCCAGTGCCTGGGGGCCATCA T → C TGGAGCAGGAATCCTCTATCTGGTC
-128
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
94
46
1
0
0.011
74
37
0
0
0.000
94
47
0
0
0.000
86
42
1
0
0.012
D76SampleSet
 
3220
PDE
24442130 GRCh37
22696128 NCBI36
  
AGTCACCATGGTAGCATCTTTAGCT A → G TTTTCAAACTAGGACTCCAAGCTTC
- 
 
n=
A/A=
A/G=
G/G=
G=
94
45
2
0
0.021
74
37
0
0
0.000
94
47
0
0
0.000
86
43
0
0
0.000
D76SampleSet
 
3221
PDE
24442107 GRCh37
22696105 NCBI36
  
CTATTTTCAAACTAGGACTCCAAGC T → C TCTTGCAAACTCTTTGCTAAATAAT
- 
 
n=
T/T=
T/C=
C/C=
C=
94
46
1
0
0.011
74
37
0
0
0.000
94
47
0
0
0.000
86
42
1
0
0.012
D76SampleSet
 
3222
PDE
24442056 GRCh37
22696054 NCBI36
  
GCCTTGGTGGCATGAGGCACATCCC T → C AAAATAGCTAATTTACTCCTAGGGA
- 
 
n=
T/T=
T/C=
C/C=
C=
94
43
4
0
0.043
74
23
14
0
0.189
94
21
16
10
0.383
86
31
11
1
0.151
D76SampleSet

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.