UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_003742
XM_005246930
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_003742 [Chr.2(-): 169779449-169887833 GRCh37]
Id:ABCB11_exon4
Position:Chr.2(-): 169869707-169870067 GRCh37
Chr.2(-): 169577953-169578313 NCBI36
Sequence:
TCCTGCTCTTCACCCATAGATGATCTCTGAACCCTTTGTTTTTCAAGTTTCGGTTTTCTTCATCAACTGACATTTGGCTG
ATGTTTGTGGGAAGTTTGTGTGCATTTCTCCATGGAATAGCCCAGCCAGGCGTGCTACTCATTTTTGGCACAATGACAGA
TGTTTT
TATTGACTACGACGTTGAGTTACAAGAACTCCAGATTCCAGGAAAAGCATGTGTGAATAACACCATTGTATGGA
CTAACAGTTCCCTCAACCAGAACATGACAAATGGAACACGTTGTGG
GTAGGTTGTTTTTGTTTTTAATTTTTTACTTTTT
TGCTCATATCTTAAATTGTAATTCAAAATGTATAGAGGGGA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB11_4_DHPLC
ABCB11_4_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 138)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 5: Coding
3289
PDE
IA
169870004 GRCh37
169578250 NCBI36
293167
TTTTTCAAGTTTCGGTTTTCTTCAT C → T AACTGACATTTGGCTGATGTTTGTG
-56
Ser → Leu
(D=145)
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: Coding
3290
PDE
I
169869997 GRCh37
169578243 NCBI36
300174
AGTTTCGGTTTTCTTCATCAACTGA C → T ATTTGGCTGATGTTTGTGGGAAGTT
-58
Asp = Asp
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: Coding
3291
PDE
5 pubsIA
169869901 GRCh37
169578147 NCBI36
396270
TTTTTGGCACAATGACAGATGTTTT T → C ATTGACTACGACGTTGAGTTACAAG
-90
Phe = Phe
n=
T/T=
T/C=
C/C=
C=
200
94
6
0
0.030
200
93
7
0
0.035
60
27
3
0
0.050
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 
3292
PDE
1 pub
169869774 GRCh37
169578020 NCBI36
  
AAATGGAACACGTTGTGGGTAGGTT G → A TTTTTGTTTTTAATTTTTTACTTTT
- 
 
n=
G/G=
G/A=
A/A=
A=
200
90
10
0
0.050
200
99
1
0
0.005
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.