UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_003742
XM_005246930
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_003742 [Chr.2(-): 169779449-169887833 GRCh37]
Id:ABCB11_exon13
Position:Chr.2(-): 169828297-169828617 GRCh37
Chr.2(-): 169536543-169536863 NCBI36
Sequence:
ATGATTCAGAACCCTGAAAGATTCCAAAAGTTGTGATGTTGTGCCCATGCTCTCTAGGTGACCGTGGATGGCCATGACAT
TCGCTCTCTTAACATTCAGTGGCTTAGAGATCAGATTGGGATAGTGGAGCAAGAGCCAGTTCTGTTCTCTACCACCATTG
CAGAAAATATTCGCTATGGCAGAGAAGATGCAACAATGGAAGACATAGTCCAAGCTGCCAAGGAGGCCAATGCCTACAAC
TTCATCATGGACCTGCCACAG
GTACCCCTAGCCATACATTCCTGGGAGAAACTAAGAGGTCATAGAAGGAAAAAAAGTTG
C
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB11_13_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 138)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3307
PDE
I
169828325 GRCh37
169536571 NCBI36
  
CTAGCCATACATTCCTGGGAGAAAC T → C AAGAGGTCATAGAAGGAAAAAAAGT
- 
 
n=
T/T=
T/C=
C/C=
C=
196
18
50
30
0.561
188
17
36
41
0.628
58
0
12
17
0.793
20
4
3
3
0.450
14
0
1
6
0.929
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.