UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_003742
XM_005246930
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_003742 [Chr.2(-): 169779449-169887833 GRCh37]
Id:ABCB11_exon18
Position:Chr.2(-): 169814399-169814700 GRCh37
Chr.2(-): 169522645-169522946 NCBI36
Sequence:
GATCTGCTGCAAAATGTCTTGAGTACATTTAGATGATTAATATAACCCTCTCTCTGCTCAAGGACAAGGACATTCCTGTG
CAGGAAGAAGTTGAACCTGCCCCAGTTAGGAGGATTCTGAAATTCAGTGCTCCAGAATGGCCCTACATGCTGGTAGGGTC
TGTGGGTGCAGCTGTGAACGGGACAGTCACACCCTTGTATGCCTTTTTATTCAGCCAGATTCTTGGG
GTAAGTACACAGC
TGGACTAGCTTTCTTCTTCTCATACCTTTTATTTTATTATTTTGATAAGTCCGCTCTTTGTT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB11_18_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 138)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3314
PDE
2 pubsIA
169814655 GRCh37
169522901 NCBI36
  
GAGTACATTTAGATGATTAATATAA C → A CCTCTCTCTGCTCAAGGACAAGGAC
- 
 
n=
C/C=
C/A=
A/A=
A=
198
42
51
6
0.318
198
34
56
9
0.374
52
4
16
6
0.538
20
3
5
2
0.450
14
3
4
0
0.286
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.