UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_003742
XM_005246930
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_003742 [Chr.2(-): 169779449-169887833 GRCh37]
Id:ABCB11_exon21
Position:Chr.2(-): 169792672-169793008 GRCh37
Chr.2(-): 169500918-169501254 NCBI36
Sequence:
GTGTAATGGTAATTGGTAAAAGCGACTGTGTGTCTGAGACGGGTTGATTGCTTTTTGGTTTGCAGGCTGCCGGCTCTCAG
ATCGGGATGATAGTCAATTCCTTCACTAACGTCACTGTGGCCATGATCATTGCCTTCTCCTTTAGCTGGAAGCTGAGCCT
GGTCATCTTGTGCTTCTTCCCCTTCTTGGCTTTATCAGGAGCCACACAGACCAGGATGTTGACAGGATTTGCCTCTCGAG
ATAAGCAGGCCCTGGAGATGGTGGGACAG
GTAATCTTGCAGATCTAATTTTCCCATTCCTCATGGCTGAGTGGCTATCAG
ACAAACTGTTAAAAACG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB11_21_DHPLC
ABCB11_21_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 138)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3320
PDE
I
169792968 GRCh37
169501214 NCBI36
  
GTAAAAGCGACTGTGTGTCTGAGAC G → A GGTTGATTGCTTTTTGGTTTGCAGG
- 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
198
99
0
0
0.000
60
27
3
0
0.050
20
9
1
0
0.050
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.