UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001532
XM_005273964
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001532 [Chr.11(-): 66129992-66139291 GRCh37]
Id:SLC29A2_exon9-10
Position:Chr.11(-): 66133342-66133788 GRCh37
Chr.11(-): 65889918-65890364 NCBI36
Sequence:
GTGTCCTGCTCCCACATGGGGCTTGGGCAAGAGGGTGGGGCCCTGGGACTGCCCTGCCTGCTCACACCCCTGCCTCTGGC
TCCCAGATCTGGCTGACAGCGCTGTGCCTTGTGTTGGTCTTCACAGTCACCCTGTCCGTCTTCCCCGCCATCACAGCCAT
GGTGACCAGCTCCACCAGTCCTGGGAAGTGGA
GTGAGTGTCAGGGTGGAGAAGACGGCAGGGCAGGGGGTACAAAGGGGA
GAGGACGGGAGAGGGGAGTTGGAGACCAGTATGAGCTGCAGCCGTTTCCCTCCCAGGTCAGTTCTTCAACCCCATCTGCT
GCTTCCTCCTCTTCAACATCATGGACTGGCTGGGACGGAGCCTGACCTCTTACTTCCTGTGG
GTAAGCACACCAGGGCTG
GGTGATCCGATGTTTTAGGAAGCAGTTTGGGATCCGAGGGCTTGAAA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC29A2_9-10_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 138)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 9: Coding
3619
PDE
1 pub
66133643 GRCh37
65890219 NCBI36
1156927
TCACAGTCACCCTGTCCGTCTTCCC C → T GCCATCACAGCCATGGTGACCAGCT
-309
Pro = Pro
n=
C/C=
C/T=
T/T=
T=
198
91
7
1
0.045
198
99
0
0
0.000
54
27
0
0
0.000
14
7
0
0
0.000
14
7
0
0
0.000
Set-I
 
3620
PDE
1 pubI
66133380 GRCh37
65889956 NCBI36
  
TAAGCACACCAGGGCTGGGTGATCC G → A ATGTTTTAGGAAGCAGTTTGGGATC
- 
 
n=
G/G=
G/A=
A/A=
A=
192
95
1
0
0.005
194
97
0
0
0.000
34
17
0
0
0.000
14
7
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.