UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_003042
XM_005265410
XM_005265411
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_003042 [Chr.3(+): 11034420-11080935 GRCh37]
Id:SLC6A1_exon3
Position:Chr.3(+): 11060217-11060473 GRCh37
Chr.3(+): 11035217-11035473 NCBI36
Sequence:
GGAACATGCCACGACAGTTCATGTTAATTCCGTATTAAATGGACGCGTGTCTGTGTTCCGCTCCCAGGCGTGGGCCTTGC
GGCTGCTGTGCTATCATTCTGGCTGAACATCTACTACATCGTCATCATCTCCTGGGCCATTTACTACCTGTACAACTCCT
TCACCACG
GTGAGTGGTCCCTTTGACCACCCCATCCAGCAGAAGCCACACCCAGAGCCCACCCTTGGCCCACCACGGCCA
CCACTCTGCTGACAAGG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC6A1_3_DHPLC
SLC6A1_3_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 5: Coding
3645
PDE
11060297 GRCh37
11035297 NCBI36
795384
TTCCGCTCCCAGGCGTGGGCCTTGC G → A GCTGCTGTGCTATCATTCTGGCTGA
+128
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3646
PDE
11060430 GRCh37
11035430 NCBI36
  
CCCCATCCAGCAGAAGCCACACCCA G → C AGCCCACCCTTGGCCCACCACGGCC
+ 
 
n=
G/G=
G/C=
C/C=
C=
200
98
2
0
0.010
200
100
0
0
0.000
60
29
0
1
0.033
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.