UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_003042
XM_005265410
XM_005265411
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_003042 [Chr.3(+): 11034420-11080935 GRCh37]
Id:SLC6A1_exon6-7
Position:Chr.3(+): 11067081-11067619 GRCh37
Chr.3(+): 11042081-11042619 NCBI36
Sequence:
AGGAAGCAAGGGTGTACAGGAGGAGGGGTCACCAGTCACCCACTTTCCTCCCAGGTGGTCTACTTTTCAGCCACATACCC
CTACATCATGCTGATCATCCTGTTCTTCCGTGGAGTGAC
GCTGCCCGGGGCCAAGGAGGGCATCCTCTTCTACATCACAC
CCAACTTCCGCAAGCTGTCTGACTCCGAG
GTGAGTGCCCCTCCCAGCCCGGATTCTGAGCCACCACTTAGCAGCTTTGAG
ATAAGCTTTTGCATCTTTCTGACCCTCACTGTAGACCAGGTTTGTTGCCAGGGAGAGCTGGTGGGCACATGGAAAAGTTC
CTGGATAGCTGCGGCTATGGTGATTACTTTTGACAGTCTTTGATAATTCTGCCTATAGGTGTGGCTGGATGCGGCAACCC
AGATCTTCTTCTCATACGGGCTGGGCCTGGGGTCCCTGAT
CGCTCTCGGGAGCTACAACTCTTTCCACAACAATGTCTAC
AG
GTTTGAGAGGACAGCTGCGGGAGCCCCTTCCTTCCTGGCCGAGCCCTTTGAGTCCAC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC6A1_6-7_DHPLC
SLC6A1_6-7_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 8: Coding
3649
PDE
11067200 GRCh37
11042200 NCBI36
1191780
TCATCCTGTTCTTCCGTGGAGTGAC G → A CTGCCCGGGGCCAAGGAGGGCATCC
+260
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
200
88
12
0
0.060
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3650
PDE
11067289 GRCh37
11042289 NCBI36
  
TCCGAGGTGAGTGCCCCTCCCAGCC C → T GGATTCTGAGCCACCACTTAGCAGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3651
PDE
11067341 GRCh37
11042341 NCBI36
  
TTGAGATAAGCTTTTGCATCTTTCT G → A ACCCTCACTGTAGACCAGGTTTGTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
98
2
0
0.010
200
96
4
0
0.020
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 9: Coding
3652
PDE
11067521 GRCh37
11042521 NCBI36
1323912
ACGGGCTGGGCCTGGGGTCCCTGAT C → T GCTCTCGGGAGCTACAACTCTTTCC
+304
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3653
PDE
11067583 GRCh37
11042583 NCBI36
  
TACAGGTTTGAGAGGACAGCTGCGG G → T AGCCCCTTCCTTCCTGGCCGAGCCC
+ 
 
n=
G/G=
G/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
28
2
0
0.033
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.