UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_003042
XM_005265410
XM_005265411
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_003042 [Chr.3(+): 11034420-11080935 GRCh37]
Id:SLC6A1_exon8
Position:Chr.3(+): 11067857-11068104 GRCh37
Chr.3(+): 11042857-11043104 NCBI36
Sequence:
CACAGCCAGCAGCTACACCTTCTGCCAGCTGCACCCTCCTCACCCCACCCCTCCCTCTCTTCAGGGACTCCATCATCGTC
TGCTGCATCAATTCGTGCACCAGCATGTTCGCAGGATTCGTCATCTTCTCCATCGTGGGCTTCATGGCCCATGTCACCAA
GAGGTCCATTGCTGATGTGGCGGCCTCAG
GTCAGTGCAACACTGTGTGGGGCCGGGCTCCTGGCATGGGGGCACTAACCA
TGCTGGCC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC6A1_8_DHPLC
SLC6A1_8_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 10: Coding
3654
PDE
11067927 GRCh37
11042927 NCBI36
1371960
CACCCCTCCCTCTCTTCAGGGACTC C → T ATCATCGTCTGCTGCATCAATTCGT
+320
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
200
96
4
0
0.020
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.