UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_003042
XM_005265410
XM_005265411
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_003042 [Chr.3(+): 11034420-11080935 GRCh37]
Id:SLC6A1_exon10
Position:Chr.3(+): 11070834-11071114 GRCh37
Chr.3(+): 11045834-11046114 NCBI36
Sequence:
CTTAGAGGGCCAGGCTTTGGGTGGGTTGGGGCTGGGGCTGCTGCAGGTGGCTGACCTCTGTTCCCACCTGAAGTTCTGCA
CTGTGGAGGGCTTCATCACAGCCCTGGTGGATGAGTACCCCAGGCTCCTCCGCAACCGCAGAGAGCTCTTCATTGC
TGCT
GTCTGCATCATCTCCTACCTGATCGGTCTCTCTAACATCACTCAG
GTAAGCTCAGTAAGCACCTGGCACTCCCCCAGCAC
TGCCCAGGGCCATGCCCAGGGCCTCCTCTCCCCTCCTCTGT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC6A1_10_DHPLC
SLC6A1_10_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3656
PDE
11070864 GRCh37
11045864 NCBI36
  
AGGGCCAGGCTTTGGGTGGGTTGGG G → T CTGGGGCTGCTGCAGGTGGCTGACC
+ 
 
n=
G/G=
G/T=
T/T=
T=
200
86
14
0
0.070
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3657
PDE
11070870 GRCh37
11045870 NCBI36
  
AGGCTTTGGGTGGGTTGGGGCTGGG G → A CTGCTGCAGGTGGCTGACCTCTGTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3658
PDE
11070877 GRCh37
11045877 NCBI36
  
GGGTGGGTTGGGGCTGGGGCTGCTG C → T AGGTGGCTGACCTCTGTTCCCACCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 12: Coding
3659
PDE
11070990 GRCh37
11045990 NCBI36
16861275
GCAACCGCAGAGAGCTCTTCATTGC T → G GCTGTCTGCATCATCTCCTACCTGA
+425
Ala = Ala
n=
T/T=
T/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.