UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon1b
Position:Chr.7(-): 87229892-87230402 GRCh37
Chr.7(-): 87067828-87068338 NCBI36
Sequence:
CTTTCTAGAGAGGTGCAACGGAAGCCAGAACATTCCTCCTGGAAATTCAACCTGTTTCGCAGTTTCTCGAGGAATCAGCA
TTCAGTCAATCCGGGCC
GGGAGCAGTCATCTGTGGTGAGGCTGATTGGCTGGGCAGGAACAGCGCCGGGGCGTGGGCTGA
GCACAGCCGCTTCGCTCTCTTTGCCACAGGAAG
CCTGAGCTCATTCGAGTAGCGGCTCTTCCAAGCTCAAAGAAGCAGAG
GCCGCTGTTCGTTTCCTTTAGGTCTTTCCACTAAAGTCGGAGTATCTTCTTCCAA
AATTTCACGTCTTGGTGGCCGTTCC
AAGGAGCGCGAG
GTAGGGGCACGCAAAGCTGGGAGCTACTATGGGACAGTTCCCAAGTGTCAGGCTTTCAGATTTCCTGA
ACTTGGTCTTCACGGGAGAAGGGCTTCTTGAGGCGTGGATAGTGTGAAGTCCTCTGGCAAGTCCATGGGGACCAAGTGGG
GTTAGATCTAGACTCAGGAGCTCCTGGAGCA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_1b_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 2: 5UTR
3677
PDE
87230305 GRCh37
87068241 NCBI36
253-805
AATCAGCATTCAGTCAATCCGGGCC G → A GGAGCAGTCATCTGTGGTGAGGCTG
- 
 
n=
G/G=
G/A=
A/A=
A=
196
98
0
0
0.000
198
99
0
0
0.000
52
25
1
0
0.019
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: 5UTR
3678
PDE
1 pub
87230209 GRCh37
87068145 NCBI36
349-709
GCTTCGCTCTCTTTGCCACAGGAAG C → G CTGAGCTCATTCGAGTAGCGGCTCT
- 
 
n=
C/C=
C/G=
G/G=
G=
196
98
0
0
0.000
198
99
0
0
0.000
56
27
1
0
0.018
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: 5UTR
2863
PDE
33 pubsI
87230193 GRCh37
87068129 NCBI36
365-693
CACAGGAAGCCTGAGCTCATTCGAG T → C AGCGGCTCTTCCAAGCTCAAAGAAG
- 
 
n=
T/T=
T/C=
C/C=
C=
196
86
10
2
0.071
198
89
10
0
0.051
56
26
2
0
0.036
20
9
0
1
0.100
14
6
1
0
0.071
Set-I
Exon 2: 5UTR
3679
PDE
I
87230107 GRCh37
87068043 NCBI36
451-607
CTAAAGTCGGAGTATCTTCTTCCAA A → G ATTTCACGTCTTGGTGGCCGTTCCA
- 
 
n=
A/A=
A/G=
G/G=
G=
196
94
4
0
0.020
198
99
0
0
0.000
56
26
2
0
0.036
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.