UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon2
Position:Chr.7(-): 87229370-87229572 GRCh37
Chr.7(-): 87067306-87067508 NCBI36
Sequence:
GTTAGTCTCACCTCCAGCGCGCCTGAGGCTCATGCATTTGGCTAATGAGCTGCGGTTTCTCTTCAGGTCGGGATGGATCT
TGAAGGGGACCGCAATGGAGGAGCAAAGAAGAAGAACTTTTTTAAACTGAAC
AATAAAAGGTAACTAGCTTGTTTCATTT
TCATAGTTTACATAGTTGCGAGATTTGAGTAATTTATTTCTAG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_2_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 3: 5UTR
3680
PDE
87229504 GRCh37
87067440 NCBI36
490-4
AATGAGCTGCGGTTTCTCTTCAGGT C → T GGGATGGATCTTGAAGGGGACCGCA
- 
 
n=
C/C=
C/T=
T/T=
T=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: 5UTR
2864
PDE
9 pubsI
87229501 GRCh37
87067437 NCBI36
493-1
GAGCTGCGGTTTCTCTTCAGGTCGG G → A ATGGATCTTGAAGGGGACCGCAATG
- 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
85
14
1
0.080
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 3: Coding
2865
PDE
19 pubsIA
87229440 GRCh37
87067376 NCBI36
55461
GAAGAAGAACTTTTTTAAACTGAAC A → G ATAAAAGGTAACTAGCTTGTTTCAT
-21
Asn → Asp
(D=23)
n=
A/A=
A/G=
G/G=
G=
200
95
5
0
0.025
200
85
14
1
0.080
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.