UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon3
Position:Chr.7(-): 87225024-87225204 GRCh37
Chr.7(-): 87062960-87063140 NCBI36
Sequence:
TTCTATGTTAATTTGGGTAATTTAAAAAATATGTACTTTTTAAAGTTTTATGTAATTCCATTGCTGTTTTGCAGTGAAAA
AGATAAGAAGGAAAAGAAACCAACTGTCAGTGTATTTTCAATG
GTGAGTTTTGAATTTATTAACTATTCAAAATACTTCG
GAAATTTGACATCTCCTTACA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_3_DHPLC
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsSample Set
no variants

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.