UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon4
Position:Chr.7(-): 87214756-87215058 GRCh37
Chr.7(-): 87052692-87052994 NCBI36
Sequence:
AGCAAATCTTCCATGAAACTGTACTAATTTTTCCTCTGCTATTCTTTTTTCTCTCTTTTTAGTTTCGCTATTCAAATTGG
CTTGACAAGTTGTATATGGTGGTGGGAACTTTGGCTGCCATCATCCATGGGGCTGGACTTCCTCTCATGATGCTGGTGTT
TGGAGAAATGACAGATATCTTTGCAAATGCAGGAAATTTAGAAGATCTGA
TGTCAAACATCACTAATAGAAGTAAGTATT
GTTTGTGTACCAATTTTATTGGAAACTTGCAGCAAAAACAAGCACTTAGAGTGATGTTTATGG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_4_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3681
PDE
87215004 GRCh37
87052940 NCBI36
  
TTTCCTCTGCTATTCTTTTTTCTCT C → G TTTTTAGTTTCGCTATTCAAATTGG
- 
 
n=
C/C=
C/G=
G/G=
G=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: Coding
3682
PDE
1 pub
87214848 GRCh37
87052784 NCBI36
759266
AATGCAGGAAATTTAGAAGATCTGA T → C GTCAAACATCACTAATAGAAGTAAG
Increased daunorubicin, doxorubicin, valinomycin or actinomycin D resistance in transformed yeast. PMID: 19940846.
-89
Met → Thr
(D=81)
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.