UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon5
Position:Chr.7(-): 87199414-87199611 GRCh37
Chr.7(-): 87037350-87037547 NCBI36
Sequence:
TCATTTTTACATGTTTATTTTTAATGGAGACTAAAGAGACATAAATGGTATGTTTGTTTTGTGGTGGTCTAGGTGATATC
AATGATACAGGGTTCTTCATGAATCTGGAGGAAGACATGACCAG
GTAATTAGACATTCTCCTTACTATTGTTAAGTTTTT
CTATATTCATCAAGTTGTAGAAATGTTTAAAACTTTGC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_5_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
2866
PDE
5 pubsI
87199564 GRCh37
87037500 NCBI36
  
AATGGAGACTAAAGAGACATAAATG G → T TATGTTTGTTTTGTGGTGGTCTAGG
- 
 
n=
G/G=
G/T=
T/T=
T=
200
53
34
13
0.300
196
69
27
2
0.158
60
26
4
0
0.067
20
6
4
0
0.200
14
3
4
0
0.286
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.