UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon12-13
Position:Chr.7(-): 87179092-87179686 GRCh37
Chr.7(-): 87017028-87017622 NCBI36
Sequence:
CCTAGTGAACAGTCAGTTCCTATATCCTGTGTCTGTGAATTGCCTTGAAGTTTTTTTCTCACTCGTCCTGGTAGATCTTG
AAGGG
CCTGAACCTGAAGGTGCAGAGTGGGCAGACGGTGGCCCTGGTTGGAAACAGTGGCTGTGGGAAGAGCACAACAGT
CCAGCTGATGCAGAGGCTCTATGACCCCACAGAGGGGATG
GTGAGATGACCCATGCGAGCTAGACCCTGCGGTGATCAGC
AGTCACATTGCACATCTTTCTGATGTTGCCCTTTCAATTACAAATGTATGAAAGTCACACTTACTTTTTATTCCAGGTCA
GTGTTGATGGACAGGATATTAGGACCATAAATGTAAGGTTTCTACGGGAAATCATTGGTGTGGTGAGTCAGGAACCTGTA
TTGTTTGCCACCACGATAGCTGAAAACATTCGCTATGGCCGTGAAAATGTCACCATGGATGAGATTGAGAAAGCTGTCAA
GGAAGCCAATGCCTATGACTTTATCATGAAACTGCCTCAT
GTAAGTTGTCCTTGCCCTTTGCCCTTCTAGAGGTGCAAAA
AATAAAATGCAGGCCTACTATGCAGGAAGTTAGGA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_12-13_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3685
PDE
I
87179616 GRCh37
87017552 NCBI36
  
TGAAGTTTTTTTCTCACTCGTCCTG G → A TAGATCTTGAAGGGCCTGAACCTGA
- 
 
n=
G/G=
G/A=
A/A=
A=
180
89
1
0
0.006
188
94
0
0
0.000
52
26
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: Coding
2868
PDE
305 pubsI
87179601 GRCh37
87017537 NCBI36
17291236
ACTCGTCCTGGTAGATCTTGAAGGG C → T CTGAACCTGAAGGTGCAGAGTGGGC
-412
Gly = Gly
n=
C/C=
C/T=
T/T=
T=
196
60
35
3
0.209
194
29
47
21
0.459
54
5
7
15
0.685
20
4
3
3
0.450
14
0
6
1
0.571
Set-I
Exon 13: Coding
3686
PDE
1 pub
87179529 GRCh37
87017465 NCBI36
18011308
ACAGTGGCTGTGGGAAGAGCACAAC A → G GTCCAGCTGATGCAGAGGCTCTATG
-436
Thr = Thr
n=
A/A=
A/G=
G/G=
G=
196
97
1
0
0.005
194
97
0
0
0.000
54
27
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3687
PDE
87179470 GRCh37
87017406 NCBI36
  
GAGGGGATGGTGAGATGACCCATGC G → A AGCTAGACCCTGCGGTGATCAGCAG
- 
 
n=
G/G=
G/A=
A/A=
A=
196
94
4
0
0.020
194
97
0
0
0.000
54
27
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3688
PDE
1 pubA
87179443 GRCh37
87017379 NCBI36
  
GCTAGACCCTGCGGTGATCAGCAGT C → T ACATTGCACATCTTTCTGATGTTGC
- 
 
n=
C/C=
C/T=
T/T=
T=
196
68
27
3
0.168
194
88
9
0
0.046
54
27
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
2986
PDE
1 pubIA
87179143 GRCh37
87017079 NCBI36
  
ATGTAAGTTGTCCTTGCCCTTTGCC C → T TTCTAGAGGTGCAAAAAATAAAATG
- 
 
n=
C/C=
C/T=
T/T=
T=
192
26
36
34
0.542
190
20
51
24
0.521
50
9
5
11
0.540
20
4
3
3
0.450
14
0
6
1
0.571
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.