UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon14
Position:Chr.7(-): 87178574-87178900 GRCh37
Chr.7(-): 87016510-87016836 NCBI36
Sequence:
CCAATTTAAAATATGAGCTGAGATAGCTTGTCCTTATGCTAAATCATTCTGGGTTTTCTGTGGTAGAAATTTGACACCCT
GGTTGGAGAGAGAGGGGCCCAGTTGAGTGGTGGGCAGAAGCAGAGGAT
CGCCATTGCACGTGCCCTGGTTCGCAACCCCA
AGATCCTCCTGCTGGATGAGGCCACGTCAGCCTTGGACACAGAAAGCGAAGCAGTGGTTCAGGTGGCTCTGGATAAG
GTC
AGTGAGGCTTAGTTCAAACCAACCTGATTTATAAACATAAGAACATTCTACTACTAATTCTTGTTAATATTGGTCTTAGA
AAAGGAA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_14_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 15: Coding
3689
PDE
87178772 GRCh37
87016708 NCBI36
21101617
TGAGTGGTGGGCAGAAGCAGAGGAT C → T GCCATTGCACGTGCCCTGGTTCGCA
-539
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
196
97
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
2869
PDE
3 pubsI
87178626 GRCh37
87016562 NCBI36
  
TAGTTCAAACCAACCTGATTTATAA A → G CATAAGAACATTCTACTACTAATTC
- 
 
n=
A/A=
A/G=
G/G=
G=
200
25
42
33
0.540
186
21
50
22
0.505
60
5
9
16
0.683
20
4
3
3
0.450
14
0
7
0
0.500
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.