UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon16
Position:Chr.7(-): 87174076-87174380 GRCh37
Chr.7(-): 87012012-87012316 NCBI36
Sequence:
GTGATTAGCTTTCATTGGTTAACACACAGCCTAATGAGCTTTTGCATATTTCTTATTTATTTTAGACAGCAGGAAATGAA
GTTGAATTAGAAAATGCAGCTGATGAATCCAAAAGTGAAATTGATGCCTTGGAAATGTCTTCAAATGATTCAAGATCCAG
TC
TAATAAGAAAAAGATCAACTCGTAGGAGTGTCCGTGGATCACAAGCCCAAGACAGAAAGCTTAGTACCAAAGAGGCTC
TG
GTATGAAGGGAGATGCGGAGTTTGTTTTAATCTCACTAACTGTGGTTCCCTAGTTTGGTGGGC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_16_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 17: Coding
3691
PDE
1 pub
87174218 GRCh37
87012154 NCBI36
24781985
TCTTCAAATGATTCAAGATCCAGTC T → G AATAAGAAAAAGATCAACTCGTAGG
-662
Leu → Arg
(D=102)
n=
T/T=
T/G=
G/G=
G=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 17: Coding
3692
PDE
3 pubs
87174198 GRCh37
87012134 NCBI36
24982005
CAGTCTAATAAGAAAAAGATCAACT C → T GTAGGAGTGTCCGTGGATCACAAGC
Increased daunorubicin, doxorubicin, valinomycin or actinomycin D resistance in transformed yeast. PMID: 19940846.
-669
Arg → Cys
(D=180)
n=
C/C=
C/T=
T/T=
T=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.