UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon21
Position:Chr.7(-): 87160537-87160887 GRCh37
Chr.7(-): 86998473-86998823 NCBI36
Sequence:
AGTTTTCAGAAAATAGAAGCATGAGTTGTGAAGATAATATTTTTAAAATTTCTCTAATTTGTTTTGTTTTGCAGGCTATA
GGTTCCAGGCTTGCTGTAATTACCCAGAATATAGCAAATCTTGGGACAGGAATAATTAT
ATCCTTCATCTATGGTTGGCA
ACTAACACTGTTACTCTTAGCAATTGTACCCATCATTGCAATAGCAGGAGTTGTTGAAATGAAAATGTTGTCTGGACAAG
CA
CTGAAAGATAAGAAAGAACTAGAAGGTGCTGGGAAGGTGAGTCAAACTAAATATGATTGATTAATTAAGTAGAGTAAA
GTATTCTAATCAGTGTTATTTTGTTACTCCC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_21_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 22: Coding
3696
PDE
1 pub
87160748 GRCh37
86998684 NCBI36
30402547
CAAATCTTGGGACAGGAATAATTAT A → G TCCTTCATCTATGGTTGGCAACTAA
-849
Ile → Met
(D=10)
n=
A/A=
A/G=
G/G=
G=
200
100
0
0
0.000
196
97
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 22: Coding
3697
PDE
I
87160645 GRCh37
86998581 NCBI36
31432650
AATGAAAATGTTGTCTGGACAAGCA C → T TGAAAGATAAGAAAGAACTAGAAGG
-884
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
196
97
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 22: Coding
2871
PDE
535 pubsI
87160618 GRCh37
86998554 NCBI36
31702677

G → A, T
GAAAGATAAGAAAGAACTAGAAGGT G → A CTGGGAAGGTGAGTCAAACTAAATA
GAAAGATAAGAAAGAACTAGAAGGT G → T CTGGGAAGGTGAGTCAAACTAAATA
Increased intracellular BODIPY-FL-paclitaxel levels (decreased function) in transfected cells. PMID: 19940846.
-893

 
Ala → Thr
(D=58)
Ala → Ser
(D=99)
n=
G/G=
G/A=
A/A=
G/T=
T/T=
A/T=
A=
T=
200
82
0
0
15
2
1
0.005
0.100
196
27
3
1
41
24
2
0.036
0.464
60
7
2
0
13
6
2
0.067
0.450
20
4
0
0
4
2
0
0.000
0.400
14
0
2
0
2
0
3
0.357
0.357
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.