UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon26
Position:Chr.7(-): 87138517-87138855 GRCh37
Chr.7(-): 86976453-86976791 NCBI36
Sequence:
TTGTGCTACATTCAAAGTGTGCTGGTCCTGAAGTTGATCTGTGAACTCTTGTTTTCAGCTGCTTGATGGCAAAGAAATAA
AGCGACTGAATGTTCAG
TGGCTCCGAGCACACCTGGGCATCGTGTCCCAGGAGCCCATCCTGTTTGACTGCAGCATTGCT
GAGAACATTGCCTATGGAGACAACAGCCGGGTGGTG
TCACAGGAAGAGATCGTGAGGGCAGCAAAGGAGGCCAACATACA
TGCCTTCATCGAGTCACTGCCTAAT
GTAAGTCTCTCTTCAAATAAACAGCCTGGGAGCATGTGGCAGCCTCTCTGGCCTA
TAGTTTGATTTATAAGGGG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_26_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 27: Coding
3700
PDE
1 pub
87138758 GRCh37
86976694 NCBI36
38153322
AGAAATAAAGCGACTGAATGTTCAG T → C GGCTCCGAGCACACCTGGGCATCGT
Decreased daunorubicin, doxorubicin, valinomycin or actinomycin D resistance in transformed yeast. PMID: 19940846.
-1108
Trp → Arg
(D=101)
n=
T/T=
T/C=
C/C=
C=
198
98
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 27: Coding
3701
PDE
2 pubsIA
87138659 GRCh37
86976595 NCBI36
39143421
CTATGGAGACAACAGCCGGGTGGTG T → A CACAGGAAGAGATCGTGAGGGCAGC
Increased daunorubicin, doxorubicin, valinomycin or actinomycin D resistance in transformed yeast. PMID: 19940846.
-1141
Ser → Thr
(D=58)
n=
T/T=
T/A=
A/A=
A=
198
80
16
3
0.111
198
99
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 27: Coding
2872
PDE
972 pubsIA
87138645 GRCh37
86976581 NCBI36
39283435
GCCGGGTGGTGTCACAGGAAGAGAT C → T GTGAGGGCAGCAAAGGAGGCCAACA
-1145
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
198
64
30
5
0.202
198
21
45
33
0.561
60
12
12
6
0.400
20
3
4
3
0.500
14
2
3
2
0.500
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.