UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon28
Position:Chr.7(-): 87133485-87133832 GRCh37
Chr.7(-): 86971421-86971768 NCBI36
Sequence:
CTTTTTATGGAAGAGGAATTAGGGAAAAGAACTATTATGAGAATTAATCTATGTGATTATGGAATAGGTTGTCCAAGAAG
CCCTGGACAAAGCCAGAGAAGGCCGCACCTGCATTGTGATTGCTCACCGCCTGTCCACCATCCAGAATGCAGACTTAATA
GTGGTGTTTCAGAATGGCAGA
GTCAAGGAGCATGGCACGCATCAGCAGCTGCTGGCACAGAAAGGCATCTATTTTTCAAT
GGTCAGTGTCCAGGCTGGAACAAAGCGCCAGTGA
ACTCTGACTGTATGAGATGTTAAATACTTTTTAATATTTGTTTAGA
T
ATGACATTTATTCAAAGTTAAAAGCAA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_28_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 29: Coding
3702
3 pubsI
87133651 GRCh37
86971587 NCBI36
42443751
AATAGTGGTGTTTCAGAATGGCAGA G → A TCAAGGAGCATGGCACGCATCAGCA
Decreased intracellular calcein levels (increased function), (ii) increased intracellular BODIPY-FL-paclitaxel levels (decreased function), in transfected cells. PMID: 19940846.
-1251
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
194
97
0
0
0.000
198
99
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 29: Coding
3703
PDE
87133635 GRCh37
86971571 NCBI36
42603767
AATGGCAGAGTCAAGGAGCATGGCA C → A GCATCAGCAGCTGCTGGCACAGAAA
-1256
Thr → Lys
(D=78)
n=
C/C=
C/A=
A/A=
A=
194
97
0
0
0.000
198
98
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 29: 3UTR
3704
PDE
1 pubI
87133538 GRCh37
86971474 NCBI36
4357 
AGTGAACTCTGACTGTATGAGATGT T → C AAATACTTTTTAATATTTGTTTAGA
- 
 
n=
T/T=
T/C=
C/C=
C=
194
82
15
0
0.077
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.