UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon1a
Position:Chr.7(-): 87230177-87230706 GRCh37
Chr.7(-): 87068113-87068642 NCBI36
Sequence:
CATTTATCATCAAATAAAGGATGAACAGATGTAACTCAGAAACTGTCAAGCATGCTGAAGAAAGACCACTGCAGAAAAAT
TTCTCCTAGCCTTTTCAAAGGTGTTAGGAAGCAGAAAGGTGATACAGAATTGGAGAGGTCGGAGTTTTTGTATTAACTGT
ATTAAATGCGAATCCCGAGAAAATTTCCCTTAACTACGTCCTGTAGTTATATGGATATGAAGACTTATGTGAACTTTGAA
AGACGTGTCTACATAAGTTGAAATGTCCCCAATGATTCAGCTGATGCGCGTTTCTCTACTTGCCCTTTCTAGAGAGGTGC
AACGGAAGCCAGAACATTCCTCCTGGAAATTCAACCTGTTTCGCAGTTTCTCGAGGAATCAGCATTCAGTCAATCCGGGC
CGGGAGCAGTCATCTGTGGTGAGGCTGATTGGCTGGGCAGGAACAGCGCCGGGGCGTGGGCTGAGCACAGCCGCTTCGCT
CTCTTTGCCACAGGAAGCCTGAGCTCATTCGA
GTAGCGGCTCTTCCAAGC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_1a_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3707
PDE
87230668 GRCh37
87068604 NCBI36
 -1168
ATAAAGGATGAACAGATGTAACTCA G → A AAACTGTCAAGCATGCTGAAGAAAG
- 
 
n=
G/G=
G/A=
A/A=
A=
192
93
3
0
0.016
188
94
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3708
PDE
87230617 GRCh37
87068553 NCBI36
 -1117
ACCACTGCAGAAAAATTTCTCCTAG C → T CTTTTCAAAGGTGTTAGGAAGCAGA
- 
 
n=
C/C=
C/T=
T/T=
T=
198
99
0
0
0.000
198
98
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3709
PDE
I
87230540 GRCh37
87068476 NCBI36
 -1040
GAGTTTTTGTATTAACTGTATTAAA T → C GCGAATCCCGAGAAAATTTCCCTTA
- 
 
n=
T/T=
T/C=
C/C=
C=
198
98
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3710
PDE
87230454 GRCh37
87068390 NCBI36
 -954
TGTGAACTTTGAAAGACGTGTCTAC A → T TAAGTTGAAATGTCCCCAATGATTC
- 
 
n=
A/A=
A/T=
T/T=
T=
198
98
0
1
0.010
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3711
PDE
3 pubsI
87230435 GRCh37
87068371 NCBI36
 -935
GTCTACATAAGTTGAAATGTCCCCA A → G TGATTCAGCTGATGCGCGTTTCTCT
- 
 
n=
A/A=
A/G=
G/G=
G=
198
99
0
0
0.000
198
99
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.