UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon10-11
Position:Chr.7(-): 87179719-87180237 GRCh37
Chr.7(-): 87017655-87018173 NCBI36
Sequence:
TGTTAGAAAAAGACAGAAGAAGTATGAAAAAAAATTGCTATCACTATCTCAGTAGCCTGATGGTTTTTCTTCACATTCCT
CAGGTATTCTTTTCTGTATTAATTGGGGCTTTTAGTGTTGGACAGGCATCTCCAAGCATTGAAGCATTTGCAAATGCAAG
AGGAGCAGCTTATGAAATCTTCAAGATAATTGATAAT
GTAAGTCTGAGTTGGCCATCTATCCACCTATCTAAAAGATTGT
CCAGTTAAGTCAATTTCTTTGTCACTTTATCCAGCTCTCCACAAAATATCACTAAAAGTAGTTATTGTAACCTAGTAATC
TCTTAAAATTTGATTCTGTTTAGAAGCCAAGTATTGACAGCTATTCGAAGAGTGGGCACAAACCAGATAATATTAAGGGA
AATTTGGAATTCAGAAATGTTCACTTCA
GTTACCCATCTCGAAAAGAAGTTAAGGTACAGTGATAAATGATTAATCAACA
ATTAATCTATTGAATGAAGAGTTTCTGATGTTTTCTTGT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_10-11_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
2867
PDE
3 pubsIA
87180198 GRCh37
87018134 NCBI36
  
AGAAGAAGTATGAAAAAAAATTGCT A → G TCACTATCTCAGTAGCCTGATGGTT
Approximately 50% of the variation in ANC nadir in cancer patients is explained by rs3765129, rs2306283 and UGT1A1*93; the AUC of irinotecan, SN-38, SN-38 glucuronide and APC are influenced by rs3740066, rs2306283, rs35605, rs10276036, and rs717620. PMID: 19940846.
- 
 
n=
A/A=
A/G=
G/G=
G=
200
54
41
5
0.255
200
31
48
21
0.450
54
5
7
15
0.685
20
4
3
3
0.450
14
0
6
1
0.571
Set-I
 
3712
PDE
I
87179935 GRCh37
87017871 NCBI36
  
TCCACAAAATATCACTAAAAGTAGT T → G ATTGTAACCTAGTAATCTCTTAAAA
- 
 
n=
T/T=
T/G=
G/G=
G=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 12: Coding
3713
PDE
37 pubsIA
87179809 GRCh37
87017745 NCBI36
16921199
TTGGAATTCAGAAATGTTCACTTCA G → A TTACCCATCTCGAAAAGAAGTTAAG
-400
Ser → Asn
(D=46)
n=
G/G=
G/A=
A/A=
A=
200
98
2
0
0.010
200
95
5
0
0.025
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.