UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_003042
XM_005265410
XM_005265411
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_003042 [Chr.3(+): 11034420-11080935 GRCh37]
Id:SLC6A1_exon9
Position:Chr.3(+): 11070356-11070603 GRCh37
Chr.3(+): 11045356-11045603 NCBI36
Sequence:
TGCTGGAAAGGCTGTAGGTGATGAGTACCTTTTATTTTTCTTCTTTTTTGCACTTCTCTGTTCAGGCCCCGGGCTGGCGT
TCCTGGCATACCCAGAGGCGGTGACCCAGCTGCCTATCTCCCCACTCTGGGCCATCCTCTTCTTCTCCATGCTGTTGATG
CTGGGCATTGACAGCCAG
GTGAGGGCGCCCCCCCCGCACCCCAGGAGCTCTCCATCCCCAGACTCCTCAGTCCCCGAGTA
AACAGGGA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC6A1_9_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3655
PDE
11070550 GRCh37
11045550 NCBI36
  

C → CC, -, CCC
GACAGCCAGGTGAGGGCGCCCCCCC C → - GCACCCCAGGAGCTCTCCATCCCCA
GACAGCCAGGTGAGGGCGCCCCCCC C → CC GCACCCCAGGAGCTCTCCATCCCCA
GACAGCCAGGTGAGGGCGCCCCCCC C → CCC GCACCCCAGGAGCTCTCCATCCCCA
+ 

 
 
 
 
n=
C/C=
C/-=
-/-=
C/CC=
CC/CC=
C/CCC=
CCC/CCC=
-/CC=
-/CCC=
CC/CCC=
-=
CC=
CCC=
200
24
41
18
9
0
1
0
7
0
0
0.420
0.080
0.005
200
93
7
0
0
0
0
0
0
0
0
0.035
0.000
0.000
60
12
13
5
0
0
0
0
0
0
0
0.383
0.000
0.000
20
8
0
1
1
0
0
0
0
0
0
0.100
0.050
0.000
14
2
5
0
0
0
0
0
0
0
0
0.357
0.000
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.