UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon10
Position:Chr.10(+): 101563705-101564121 GRCh37
Chr.10(+): 101553695-101554111 NCBI36
Sequence:
TGAGCTTCCTCTTCTACTCCCTAGTATCCTTGGCTTTGTCCATGGGTCCTAATTTCAATCCTTATCTTTAGGCATTGACC
CTATCCAACTTGGCCAGGAAGGAGTACACCGTTGGAGAAACAGTGAACCTGATGTCTGTGGATGCCCAGAAGCTCATGGA
TGTGACCAACTTCATGCACATGCTGTGGTCAAGTGTTCTACAGATTGTCTTATCTATCTTCTTCCTATGGAGAGAGTTGG
GACCCTCAGTCTTAGCAGGTGTTGGGGTGATGGTGCTTGTAATCCCAATTAATGC
GATACTGTCCACCAAGAGTAAGACC
ATTCAG
GTAAAGAAAAAGTCACCCAGAAGAATATAAGCTTTCTTTAAAGTGTAAACCCTTTTTCTTACTCTACTCTAATT
CTTAATGGGAGTTTGGG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_10_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 10: Coding
3809
PDE
I
101563785 GRCh37
101553775 NCBI36
13581219
CAATCCTTATCTTTAGGCATTGACC C → T TATCCAACTTGGCCAGGAAGGAGTA
+407
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
196
91
7
0
0.036
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 10: Coding
3810
PDE
69 pubsIA
101563815 GRCh37
101553805 NCBI36
13881249
CAACTTGGCCAGGAAGGAGTACACC G → A TTGGAGAAACAGTGAACCTGATGTC
+417
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
200
69
28
3
0.170
200
68
30
2
0.170
60
24
5
1
0.117
20
7
3
0
0.150
14
7
0
0
0.000
Set-I
Exon 10: Coding
3811
PDE
I
101564000 GRCh37
101553990 NCBI36
15731434
TGGTGCTTGTAATCCCAATTAATGC G → T ATACTGTCCACCAAGAGTAAGACCA
+478
Ala = Ala
n=
G/G=
G/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 10: Coding
3812
PDE
1 pub
101564023 GRCh37
101554013 NCBI36
15961457
GCGATACTGTCCACCAAGAGTAAGA C → T CATTCAGGTAAAGAAAAAGTCACCC
+486
Thr → Ile
(D=89)
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.