UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon11
Position:Chr.10(+): 101565082-101565276 GRCh37
Chr.10(+): 101555072-101555266 NCBI36
Sequence:
CCTGAGCCCTCTCTCATGGAAGCGTATATTGTTTTTCTTTTGCTTTTTTCCTGGCAGGTCAAAAATATGAAGAATAAAGA
CAAACGTTTAAAGATCATGAATGAGATTCTTAGTGGAATCAAG
GTGAGAATCTGAGCGTAGGTGGCTCTCTGTGGGTAAG
GACAGAAGCAGTGGCTCTCTTGGCCTTTGCAAACC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_11_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3813
PDE
101565114 GRCh37
101555104 NCBI36
  
CCTCTCTCATGGAAGCGTATATTGT T → G TTTCTTTTGCTTTTTTCCTGGCAGG
+ 
 
n=
T/T=
T/G=
G/G=
G=
196
97
1
0
0.005
198
99
0
0
0.000
50
25
0
0
0.000
18
9
0
0
0.000
12
5
1
0
0.083
Set-I
Exon 11: Coding
3814
PDE
101565157 GRCh37
101555147 NCBI36
16221483
CTGGCAGGTCAAAAATATGAAGAAT A → G AAGACAAACGTTTAAAGATCATGAA
+495
Lys → Glu
(D=56)
n=
A/A=
A/G=
G/G=
G=
198
99
0
0
0.000
198
98
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.