UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exonPa
Position:Chr.10(+): 101540905-101541604 GRCh37
Chr.10(+): 101530895-101531594 NCBI36
Sequence:
CAGATGACTTGTGAAGTTGATTCAGTTGTCATATACCTGTTGGCCATTTATATGTCTTCTTTGGAAAAGTGTCTGTTCAA
GTCCTTTGCCCACTTTTTAATTTGTTAGTGTATGTTTGCTATTGAGTTGTATGAGTTCCTTATAGTATATTGTGGATATT
AACTCTTCATCAGTTATATGGTCTGCAAATATTTTCTCCCACACTGAATGCTGCCTTTTCATTTTTTTTATGTGTATACT
TGACTTTTAAAATCAGTAACAAGGTCCATACAATTCACATTTGGCTGATATGCCTCTTGATTCTCTTGTAATTTGTAAGT
TCCTTTGACTCCTTTCCTTCTTTTAATTTATTTATTAAAAAATGGAATCATTTGCACTATAGAATCTCCCACATTCTGGA
TTTTGACAATTGCATTCCAATGGAGTCCTTTAGCATGTTCCTGTGTTTCTTATAATCCGGTAGTTAGATCTAGAATTTGA
CCAGATTTAAGGCCAATTTTTTTTAGCTAGGATACTGCATGGGTGGTTATGTTTTAGCTAGGATACCGCATGGGTGGTTC
ATGATATCATGAAAAAAGCATGTTCTTAAAGCAATTTAAGTGACAGTACAAAAGGTTGGGTCAGGTGGGGCACGGTAGCT
CATGCCTGCAATCCCAGCCCTTTGGGAGGCCAAGGCAGAAGGATTGTTGAAGCCTGGAGT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_Pa_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3821
PDE
101540955 GRCh37
101530945 NCBI36
-1508-1647
TTGTCATATACCTGTTGGCCATTTA T → C ATGTCTTCTTTGGAAAAGTGTCTGT
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
95
5
0
0.025
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3822
PDE
101541039 GRCh37
101531029 NCBI36
-1424-1563
GTATGTTTGCTATTGAGTTGTATGA G → A TTCCTTATAGTATATTGTGGATATT
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3823
PDE
8 pubs
101541053 GRCh37
101531043 NCBI36
-1410-1549
GAGTTGTATGAGTTCCTTATAGTAT A → G TTGTGGATATTAACTCTTCATCAGT
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
23
51
26
0.515
200
21
44
35
0.570
60
1
7
22
0.850
20
0
4
6
0.800
14
1
3
3
0.643
Set-I
 
3824
PDE
I
101541310 GRCh37
101531300 NCBI36
-1153-1292
AGAATCTCCCACATTCTGGATTTTG A → G CAATTGCATTCCAATGGAGTCCTTT
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3825
PDE
101541363 GRCh37
101531353 NCBI36
-1100-1239
CATGTTCCTGTGTTTCTTATAATCC G → A GTAGTTAGATCTAGAATTTGACCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
94
6
0
0.030
200
99
1
0
0.005
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 
3826
PDE
101541537 GRCh37
101531527 NCBI36
-926-1065
ACAAAAGGTTGGGTCAGGTGGGGCA C → A GGTAGCTCATGCCTGCAATCCCAGC
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 
3827
PDE
101541542 GRCh37
101531532 NCBI36
-921-1060
AGGTTGGGTCAGGTGGGGCACGGTA G → GG CTCATGCCTGCAATCCCAGCCCTTT
+ 
 
n=
G/G=
G/GG=
GG/GG=
GG=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.