UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon22-23
Position:Chr.10(+): 101591309-101591953 GRCh37
Chr.10(+): 101581299-101581943 NCBI36
Sequence:
TGATTCCTTATCAAAAGCCATTAGGGAGTTCTACTAATATTGAGGTGGGGACTTTGCAGGTGAAGTTCTCCATCTACCTG
GAGTACCTACAAGCAATAGGATTGTTTTC
GATATTCTTCATCATCCTTGCGTTTGTGATGAATTCTGTGGCTTTTATTGG
ATCCAACCTCTGGCTCAGTGCTTGGACCAGTGACTCTAAAATCTTCAATAGCACCGACTATCCAGCATCTCAGAGGGACA
TGAGAGTTGGAGTCTACGGAGCTCTGGGATTAGCCCAAG
GTATGTCTGATGGCTATGACATCTTACAGAATCTGTCTGGA
CCCTGTACTTTTCCTGGACTCAGGAATGCATTTGCCATTATGTCCTGGGCACAAGTCTTCAGGGATTCCTGTGCATGGTG
CTGACAAAACTGCTTCCATCTCTAGGTATATTTGTGTTCATAGCACATTTCTGGAGTGCCTTTGGTTTCGTCCATGCATC
AAATATCTTGCACAAGCAACTGCTGAACA
ATATCCTTCGAGCACCTATGAGATTTTTTGACACAACACCCACAGGCCGGA
TTGTGAACAGGTTTGCCGGC
GTAAGTATCTCAAGAACTGTCAGGTGGTGTGTTTATATACTGAGGATCTTTCTGATAGGG
AGGAA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_22-23_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 22: Coding
3828
PDE
I
101591385 GRCh37
101581375 NCBI36
30402901
CTTTGCAGGTGAAGTTCTCCATCTA C → A CTGGAGTACCTACAAGCAATAGGAT
+967
Tyr → STOP
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 22: Coding
3829
PDE
1 pubI
101591418 GRCh37
101581408 NCBI36
30732934
ACCTACAAGCAATAGGATTGTTTTC G → A ATATTCTTCATCATCCTTGCGTTTG
+978
Ser = Ser
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
198
99
0
0
0.000
60
26
4
0
0.067
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 22: Coding
3830
PDE
101591428 GRCh37
101581418 NCBI36
30832944
AATAGGATTGTTTTCGATATTCTTC A → G TCATCCTTGCGTTTGTGATGAATTC
+982
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 23: Coding
3831
PDE
101591737 GRCh37
101581727 NCBI36
32463107
ACAAAACTGCTTCCATCTCTAGGTA T → C ATTTGTGTTCATAGCACATTTCTGG
+1036
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
200
99
1
0
0.005
198
98
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 23: Coding
3832
PDE
101591818 GRCh37
101581808 NCBI36
33273188
ATCTTGCACAAGCAACTGCTGAACA A → G TATCCTTCGAGCACCTATGAGATTT
+1063
Asn → Ser
(D=46)
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.