UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exonPb
Position:Chr.10(+): 101541447-101542160 GRCh37
Chr.10(+): 101531437-101532150 NCBI36
Sequence:
ATACCGCATGGGTGGTTCATGATATCATGAAAAAAGCATGTTCTTAAAGCAATTTAAGTGACAGTACAAAAGGTTGGGTC
AGGTGGGGCACGGTAGCTCATGCCTGCAATCCCAGCCCTTTGGGAGGCCAAGGCAGAAGGATTGTTGAAGCCTGGAGTTT
GAGACCAGCCTGGGCAACATAGTGAGACCCCGTCCCTACAGAAAACATTTTTTTAATTAGCTGGGCTTGTTGGCATGTGC
CTGTAGTCCCAGCTACTCAGGAAGCTGAGGCAGGAAGATCGCTTGAACCCATGAGGTCAAGGCTGCAATGAATCATGATG
GCAACACTGCACTCTAGCTCAGGCAACAGACCAAGACCCTGTCTCAAAAAACAAAAAACAATAACAAAAAAAGAAAAGGT
TGGGTCGATGACAGTTTCTAGCGACTGATGCCACCACTCTGTTTACAGAATCACCCCTCTCCTCTGGCCCTGATGTTTTA
TCATGATATCATATTTACAATGCCTGGCAAAGGCTTCATTCCCATTTGGCATACTACCTCTCAGGCAAATAGAACTTTTG
AAAGCCTGTATTATGTATATAACATATAGGCTCACACTGGATAAGCTATTTTATAACCTGACTTCTTCAAAGAAAGTTTA
CATCATGTTTAAACCATGTTTTAGATTCTATATTTTTAATTAAAAATCTAAGGAAGAAGGATATTTCACATTTC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_Pb_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3826
PDE
101541537 GRCh37
101531527 NCBI36
-926-1065
ACAAAAGGTTGGGTCAGGTGGGGCA C → A GGTAGCTCATGCCTGCAATCCCAGC
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 
3827
PDE
101541542 GRCh37
101531532 NCBI36
-921-1060
AGGTTGGGTCAGGTGGGGCACGGTA G → GG CTCATGCCTGCAATCCCAGCCCTTT
+ 
 
n=
G/G=
G/GG=
GG/GG=
GG=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3833
PDE
3 pubs
101541579 GRCh37
101531569 NCBI36
-884-1023
AATCCCAGCCCTTTGGGAGGCCAAG G → A CAGAAGGATTGTTGAAGCCTGGAGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
74
25
1
0.135
200
80
19
1
0.105
60
18
8
4
0.267
20
5
4
1
0.300
14
2
4
1
0.429
Set-I
 
3834
PDE
6 pubs
101541583 GRCh37
101531573 NCBI36
-880-1019
CCAGCCCTTTGGGAGGCCAAGGCAG A → G AGGATTGTTGAAGCCTGGAGTTTGA
ABCC2*2 (-1019A>G) is associated with lower irinotecan clearance and with significant reduction of severe diarrhea in cancer patients. PMID: 19940846.
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
40
47
13
0.365
200
35
44
21
0.430
60
21
8
1
0.167
20
6
4
0
0.200
14
3
3
1
0.357
Set-I
 
3835
PDE
101541804 GRCh37
101531794 NCBI36
-659-798
TCTAGCTCAGGCAACAGACCAAGAC C → A CTGTCTCAAAAAACAAAAAACAATA
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3836
PDE
101541869 GRCh37
101531859 NCBI36
-594-733
GGTTGGGTCGATGACAGTTTCTAGC G → A ACTGATGCCACCACTCTGTTTACAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.