UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon18-19
Position:Chr.10(+): 101578491-101579084 GRCh37
Chr.10(+): 101568481-101569074 NCBI36
Sequence:
TTCTGTGAAGGTGGATCTAGGGAGTAGTGCTTAATATGAATTATTTTCTTCTTCAGGGTATAAATCTTAGTGGGGGTCAG
AAGCAGCGGATCAGCCTGGCCAGAGCTACCTACCAAAATTTAGACATCTATCTTCTAGATGACCCCCTGTCTGCAGTGGA
TGCTCATGTAGGAAAACATATTTTTAATAAGGTCTTGGGCCCCAATGGCCTGTTGAAAGGCAAG
GTGAGAAATCATTGAA
CATGATGAAGATATAAAGGTGGGGTGGGAGGGAGAGGGGAGGACATGTCTGGCAAGTAAGACAGGGAAGATGGTGGACAT
ATGGTAATCAACACAACTTCATATTATTTTTATAGACTCGACTCTTGGTTACACATAGCATGCACTTTCTTCCTCAAGTG
GATGAGATTGTAGTTCTGGGGAATGGAACAATTGTAGAGAAAGGATCCTACAGTGCTCTCC
TGGCCAAAAAAGGAGAGTT
TGCTAAGAATCTGAAGACATTTCTAAGACATACAGGCCCTGAAGAGGAAGCCACAG
GTATGTAAGAAGGATTGGGACAAG
ATAGAACTTGGGCCATGGGTGGAATGGTAAATCA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_18-19_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 19: Coding
3837
PDE
101578952 GRCh37
101568942 NCBI36
26852546
GAGAAAGGATCCTACAGTGCTCTCC T → G GGCCAAAAAAGGAGAGTTTGCTAAG
+849
Leu → Arg
(D=102)
n=
T/T=
T/G=
G/G=
G=
194
96
1
0
0.005
200
98
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.