UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon25
Position:Chr.10(+): 101595785-101596122 GRCh37
Chr.10(+): 101585775-101586112 NCBI36
Sequence:
GGAGGAAGATGGTGGATGCCTCATGACTGCGGGACTGGCTGATTCTTTACTTTTTGTGTCCAGATGTTTTATGTGTCTAC
CTCCCGCCAGCTGAGGCGTCTGGACTCTGTCACCAGGTCCCCAATCTACTCTCACTTCAGCGAGACCGTATCAGGTTTGC
CAGTTATCCGTGCCTTTGAGCACCAGCAGC
GATTTCTGAAACACAATGAGGTGAGGATTGACACCAACCAGAAATGTGTC
TTTTCCTGGATCACCTCCAACAG
GTGAGGCTTCCCCTGGGTATTTACCCATGTGTGTACTTTGGGGTTCTATATGTTTGA
TATTAGCGGTGGGAGGGC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_25_DHPLC
ABCC2_25_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3839
PDE
101595815 GRCh37
101585805 NCBI36
  
AAGATGGTGGATGCCTCATGACTGC G → A GGACTGGCTGATTCTTTACTTTTTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
98
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 25: Coding
3840
PDE
2 pubsI
101595975 GRCh37
101585965 NCBI36
36813542
ATCCGTGCCTTTGAGCACCAGCAGC G → T ATTTCTGAAACACAATGAGGTGAGG
+1181
Arg → Leu
(D=102)
n=
G/G=
G/T=
T/T=
T=
200
83
17
0
0.085
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 25: Coding
3841
PDE
1 pub
101595994 GRCh37
101585984 NCBI36
37003561
AGCAGCGATTTCTGAAACACAATGA G → A GTGAGGATTGACACCAACCAGAAAT
+1187
Glu = Glu
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 25: Coding
3842
PDE
13 pubsI
101595996 GRCh37
101585986 NCBI36
37023563
CAGCGATTTCTGAAACACAATGAGG T → A GAGGATTGACACCAACCAGAAATGT
+1188
Val → Glu
(D=121)
n=
T/T=
T/A=
A/A=
A=
200
88
11
1
0.065
200
86
13
1
0.075
60
30
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 
3843
PDE
101596053 GRCh37
101586043 NCBI36
  
TCCTGGATCACCTCCAACAGGTGAG G → C CTTCCCCTGGGTATTTACCCATGTG
+ 
 
n=
G/G=
G/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.