UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon27
Position:Chr.10(+): 101603488-101603729 GRCh37
Chr.10(+): 101593478-101593719 NCBI36
Sequence:
TTGTGGTTTGAGTGGTTGAGTTGGTTTCTGTGCCTATGATGATTTTCAGTCTTCTGGTTTTTCTGTAGATCACACAAACC
CTGAACTGGCTGGTGAGGATGACATCAGAAATAGAGACCAACATTGTGGCTGTTGAGCGAATA
ACTGAGTACACAAAAGT
GGAAAATGAG
GTAAGGAGGAACTGGAAAAATCCAGGAACAAGGCAAAAACAACATGCAACTCCTTCGAGAGTGCATCTTT
AG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_27_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3846
PDE
A
101603522 GRCh37
101593512 NCBI36
  
GAGTGGTTGAGTTGGTTTCTGTGCC T → C ATGATGATTTTCAGTCTTCTGGTTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
54
42
4
0.250
194
65
31
1
0.170
56
27
1
0
0.018
20
9
1
0
0.050
14
6
1
0
0.071
Set-I
Exon 27: Coding
3847
PDE
A
101603631 GRCh37
101593621 NCBI36
39563817
CAACATTGTGGCTGTTGAGCGAATA A → G CTGAGTACACAAAAGTGGAAAATGA
+1273
Thr → Ala
(D=58)
n=
A/A=
A/G=
G/G=
G=
200
98
2
0
0.010
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.