UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon28
Position:Chr.10(+): 101604011-101604284 GRCh37
Chr.10(+): 101594001-101594274 NCBI36
Sequence:
TCCTGGGTGGACTGTTCGGCTGAGTTGCCACCTTATAAAACTTACTTCTCATCTTGTCTCCTTGCCAGGCACCCTGGGTG
ACTGATAAGAGGCCTC
CGCCAGATTGGCCCAGCAAAGGCAAGATCCAGTTTAACAACTACCAAGTGCGGTACCGACCTGA
GCTGGATCTGGTCCTCAGAGGGATCACTTGTGACAT
CGGTAGCATGGAGAAGGTAGGTGGAGTGAAGGAAGGCCTGGATG
GGAGGCCTTGTGATCAAACAACAATTGGACAGAG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_28_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 28: Coding
3848
PDE
1 pub
101604107 GRCh37
101594097 NCBI36
40113872
CCCTGGGTGACTGATAAGAGGCCTC C → T GCCAGATTGGCCCAGCAAAGGCAAG
+1291
Pro → Leu
(D=98)
n=
C/C=
C/T=
T/T=
T=
194
93
4
0
0.021
196
97
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 28: Coding
3849
PDE
51 pubs
101604207 GRCh37
101594197 NCBI36
41113972
TCCTCAGAGGGATCACTTGTGACAT C → T GGTAGCATGGAGAAGGTAGGTGGAG
Approximately 50% of the variation in ANC nadir in cancer patients is explained by rs3765129, rs2306283 and UGT1A1*93; the AUC of irinotecan, SN-38, SN-38 glucuronide and APC are influenced by rs3740066, rs2306283, rs35605, rs10276036, and rs717620. PMID: 19940846.
+1324
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
194
51
39
7
0.273
196
40
41
17
0.383
58
18
11
0
0.190
20
5
5
0
0.250
14
2
5
0
0.357
Set-I
 
3850
PDE
101604243 GRCh37
101594233 NCBI36
  
AGAAGGTAGGTGGAGTGAAGGAAGG C → T CTGGATGGGAGGCCTTGTGATCAAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
180
90
0
0
0.000
188
91
3
0
0.016
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.