UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon29
Position:Chr.10(+): 101605308-101605604 GRCh37
Chr.10(+): 101595298-101595594 NCBI36
Sequence:
GAATGCCCAGGCTAAATAACTTTTCCCCAAGAATTATTTGTGGAACTAATGTGTAAGGGAACTATATTCGCAGATTGGTG
TGGTGGGCAGGACAGGAGCTGGAAAGTCATCCCTCACAAACTGCCTCTTCAGAATCTTAGAGGCTGC
CGGTGGTCAGATT
ATCATTGATGGAGTAGATATTGCTTCCATTGGGCT
CCACGACCTCCGAGAGAAGCTGACCATCATCCCCCAGGTGAGCTC
TAGAACTTACTCGGGCACATGCCGTGGGGAGCAGCTTGTTTTACAGGAAACATATGC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_29_DHPLC
ABCC2_29_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 29: Coding
3851
PDE
101605455 GRCh37
101595445 NCBI36
42014062
GCCTCTTCAGAATCTTAGAGGCTGC C → T GGTGGTCAGATTATCATTGATGGAG
+1354
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
200
94
6
0
0.030
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 29: Coding
3852
PDE
IA
101605503 GRCh37
101595493 NCBI36
42494110
GAGTAGATATTGCTTCCATTGGGCT C → T CACGACCTCCGAGAGAAGCTGACCA
+1370
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
200
84
14
2
0.090
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 
3853
PDE
A
101605550 GRCh37
101595540 NCBI36
  
ACCATCATCCCCCAGGTGAGCTCTA G → C AACTTACTCGGGCACATGCCGTGGG
+ 
 
n=
G/G=
G/C=
C/C=
C=
200
88
11
1
0.065
200
86
13
1
0.075
60
30
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.