UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon30
Position:Chr.10(+): 101606648-101606957 GRCh37
Chr.10(+): 101596638-101596947 NCBI36
Sequence:
CAGTCCTGAGGAACTCCGAGGTCCTTTTCTGGCATGAGCCCCAACAGCCCCCTTGTCCTTTCACTTGCAGGACCCCATCC
TGTTCTCTGGAAGCCTGAGGATGAATCTCGACCCTTTCAACAACTACTCAGATGAGGAGATTTGGAAGGCCTTGGAGCTG
GCTCA
CCTCAAGTCTTTTGTGGCCAGCCTGCAACTTGGGTTATCCCACGAAGTGACAGAGGCTGGTGGCAACCTGAGGTA
ATGTTCCATAGCCTGCTACCCCTGCAGGCAATGAGAGGATGTGAGGGGGCCACTCCTCGTGTTCCTCGTG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_30_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3854
PDE
I
101606683 GRCh37
101596673 NCBI36
  
GAACTCCGAGGTCCTTTTCTGGCAT G → A AGCCCCAACAGCCCCCTTGTCCTTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
188
69
23
2
0.144
184
87
5
0
0.027
60
29
1
0
0.017
20
6
4
0
0.200
14
7
0
0
0.000
Set-I
Exon 30: Coding
3855
PDE
1 pubI
101606813 GRCh37
101596803 NCBI36
43814242
TTTGGAAGGCCTTGGAGCTGGCTCA C → T CTCAAGTCTTTTGTGGCCAGCCTGC
+1414
His = His
n=
C/C=
C/T=
T/T=
T=
192
95
1
0
0.005
190
95
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 30: Coding
3856
PDE
I
101606861 GRCh37
101596851 NCBI36
44294290
TGCAACTTGGGTTATCCCACGAAGT G → T ACAGAGGCTGGTGGCAACCTGAGGT
+1430
Val = Val
n=
G/G=
G/T=
T/T=
T=
192
82
13
1
0.078
190
82
12
1
0.074
60
30
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 
3857
PDE
101606895 GRCh37
101596885 NCBI36
  
TGGTGGCAACCTGAGGTAATGTTCC A → C TAGCCTGCTACCCCTGCAGGCAATG
+ 
 
n=
A/A=
A/C=
C/C=
C=
192
95
1
0
0.005
190
95
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.