UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon31
Position:Chr.10(+): 101610302-101610621 GRCh37
Chr.10(+): 101600292-101600611 NCBI36
Sequence:
CCTGCGTCTTTCCTTGGTCTTTAGGAGCTAACACATGGTTGCTTCTATTGGCTGCAGCATAGGCCAGAGGCAGCTGCTGT
GCCTGGGCAGGGCTCTGCTTCGGAAATCCAAGATCCTGGTCCTGGATGAGGCCACTGCTGCGGTGGATCTAGA
GACAGAC
AACCTCATTCAGACGACCATCCAAAACGAGTTCGCCCACTGCACAGTGATCACCATCGCCCACAGGCTGCA
CACCATCAT
GGACAGTGACAA
GTGAGTGTAGGGGGACAGGGCTTGACACGGATGGCTTAACCCTTGCTCAACAGTAACAGTGTCAGCCG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_31_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 31: Coding
3858
PDE
I
101610455 GRCh37
101600445 NCBI36
45494410
AGGCCACTGCTGCGGTGGATCTAGA G → A ACAGACAACCTCATTCAGACGACCA
+1470
Glu = Glu
n=
G/G=
G/A=
A/A=
A=
198
72
25
2
0.146
200
93
7
0
0.035
60
29
1
0
0.017
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 31: Coding
3859
PDE
2 pubsI
101610533 GRCh37
101600523 NCBI36
46274488
TGATCACCATCGCCCACAGGCTGCA C → T ACCATCATGGACAGTGACAAGTGAG
+1496
His = His
n=
C/C=
C/T=
T/T=
T=
198
92
7
0
0.035
200
88
12
0
0.060
60
29
1
0
0.017
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 
3860
PDE
101610565 GRCh37
101600555 NCBI36
  
ATGGACAGTGACAAGTGAGTGTAGG G → A GGACAGGGCTTGACACGGATGGCTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
198
86
12
1
0.071
200
86
14
0
0.070
60
29
1
0
0.017
20
10
0
0
0.000
14
6
1
0
0.071
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.