UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exonPc
Position:Chr.10(+): 101541985-101542647 GRCh37
Chr.10(+): 101531975-101532637 NCBI36
Sequence:
TCTCAGGCAAATAGAACTTTTGAAAGCCTGTATTATGTATATAACATATAGGCTCACACTGGATAAGCTATTTTATAACC
TGACTTCTTCAAAGAAAGTTTACATCATGTTTAAACCATGTTTTAGATTCTATATTTTTAATTAAAAATCTAAGGAAGAA
GGATATTTCACATTTCTATAAACTCTAAGATCTTGCAGCAGAAGCGAAACTGCACATTTAGGGGTGCCTGCCCCTCTACT
GATGCTGCCCTTTGTGGGTCATATGTCCTTAGGAAAATGAAAGACTGTGCACTCTTGATTTGTTGGCCAGCTCTGTTGAC
ATCTTTCAGTGGTTCCTTTTATGTATGGCCACTCCTACAGAGGCCTCTTGTACTTTGGGAACTGGTGAGTCTCCCTGTCC
CTAGGGCTTTTTAGTCACATGTCCATCCACTGTTTCAATGTAACATGCATCTAGGCAAGGTTAACGATTAAATGGTTGGG
ATGAAAGGTCATCCTTTACGGAGAACATCAGAATGGTAGATAATTCCTGTTCCACTTTCTTTGATGAAACAAGTAAAGAA
GAAACAACACAATCATATTAATAGAAGAGTCTT
CGTTCCAGACGCAGTCCAGGAATCATGCTGGAGAAGTTCTGCAACTC
TACTTTTTGGGTGAGAAATTACA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_Pc_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 1: 5UTR
3861
PDE
84 pubsIA
101542578 GRCh37
101532568 NCBI36
116-24
ACAATCATATTAATAGAAGAGTCTT C → T GTTCCAGACGCAGTCCAGGAATCAT
Approximately 50% of the variation in ANC nadir in cancer patients is explained by rs3765129, rs2306283 and UGT1A1*93; the AUC of irinotecan, SN-38, SN-38 glucuronide and APC are influenced by rs3740066, rs2306283, rs35605, rs10276036, and rs717620. PMID: 19940846.
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
88
12
0
0.060
200
64
33
3
0.195
60
22
7
1
0.150
20
7
3
0
0.150
14
3
4
0
0.286
Set-I
Exon 1: 5UTR
3862
PDE
1 pubI
101542579 GRCh37
101532569 NCBI36
117-23
CAATCATATTAATAGAAGAGTCTTC G → A TTCCAGACGCAGTCCAGGAATCATG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
5
2
0
0.143
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.