UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon20-21
Position:Chr.10(+): 101589994-101590677 GRCh37
Chr.10(+): 101579984-101580667 NCBI36
Sequence:
TCTCTCCTTGTTCATAGGACTGACAGGGATCTATGCAGCTCTTTCCCTAACCTCTACTGTGTCTCCCTAGTCCATGATGG
CAGTGAAGAAGAAGACGATGACTATGGGCTGATATCCAGTGTGGAAGAGATCCCCGAAGATGCAGCCTCCATAACCATGA
GAAGAGAGAACAGCTTTCGTCGAACACTTAGCCGCAG
GTTGGCTATCTATTCAGCTGGCAGCCCTCGTCAGCTCTATATT
TCCACTTGATCTTTTTCTTTTTCTTCCTGGGCTTTTCCTGTGAGGGTTAACACCATGGACACTCCAAGCTCTTCCTTTGT
TTCTTTGTTGTGGGGATGGGGAAAGATCGGGGTTGTGTCAGTTTCCCCTGGTCATCTGCCCTGAAATGCGCTTTGATGCC
AGCTGAGTGACTGTGACATCTGCTTGCAAGAAGACCCTTGGGAATTGCCTGCATGCTCAGGGAAGCTTCCCTCTCTCAGT
TCTAGGTCCAATGGCAGGCATCTGAAGTCCCTGAGAAACTCCTTGAAAACTCGGAATGTGAATAGCCTGAAGGAAGACGA
AGAACTAGTGAAAGGACAAAAACTAATTAAGAAGGAATTCATAGAAACTGGAAAG
GTGAACACCACACAGAAAAGTAGCA
TTTGAGGTGTTATAAGGTTTAGAACCCAAAATTTTTAACGTTCA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_20-21_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3863
PDE
101590219 GRCh37
101580209 NCBI36
  
GGCTATCTATTCAGCTGGCAGCCCT C → A GTCAGCTCTATATTTCCACTTGATC
+ 
 
n=
C/C=
C/A=
A/A=
A=
184
92
0
0
0.000
184
92
0
0
0.000
50
24
1
0
0.020
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3864
PDE
101590382 GRCh37
101580372 NCBI36
  
TCCCCTGGTCATCTGCCCTGAAATG C → T GCTTTGATGCCAGCTGAGTGACTGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
198
97
2
0
0.010
200
100
0
0
0.000
56
28
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
 
3865
PDE
101590460 GRCh37
101580450 NCBI36
  
GAATTGCCTGCATGCTCAGGGAAGC T → G TCCCTCTCTCAGTTCTAGGTCCAAT
+ 
 
n=
T/T=
T/G=
G/G=
G=
196
97
1
0
0.005
196
98
0
0
0.000
56
28
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.