UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001043
NM_001172501
NM_001172504
NM_001172502
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001043 [Chr.16(+): 55690352-55737700 GRCh37]
Id:SLC6A2_exon7
Position:Chr.16(+): 55729110-55729389 GRCh37
Chr.16(+): 54286611-54286890 NCBI36
Sequence:
GGTTCTATAGCCAGCCCAGCAGTCAAAACACAGGGTTGAGGGTGTCAAGGGACTTGACCTCACTGTGCTTCTTCCCCCAG
GGATGCCCTGCTGACCAGCAGCATCAACTGTATCACCAGCTTCGTCTCTGGGTTCGCCATCTTCTCCATCCTTGGTTACA
TGGCCCATGAACACAAGGTCAACATTGAGGATGTGGCCACAGAAG
GTGGGTGGGCAGCCCACCTGGGCCCCAGCCCACTG
AGGCGGGAGCTGAGAAGCCCACCTTATTCTTGGCTGCATG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC6A2_7_DHPLC
SLC6A2_7_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3870
PDE
55729143 GRCh37
54286644 NCBI36
  
AGCCAGCCCAGCAGTCAAAACACAG G → C GTTGAGGGTGTCAAGGGACTTGACC
+ 
 
n=
G/G=
G/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3871
PDE
55729149 GRCh37
54286650 NCBI36
  
CCCAGCAGTCAAAACACAGGGTTGA G → T GGTGTCAAGGGACTTGACCTCACTG
+ 
 
n=
G/G=
G/T=
T/T=
T=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: Coding
3872
PDE
55729190 GRCh37
54286691 NCBI36
12781023
GACCTCACTGTGCTTCTTCCCCCAG G → A GATGCCCTGCTGACCAGCAGCATCA
+341
Arg = Arg
n=
G/G=
G/A=
A/A=
A=
200
95
5
0
0.025
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: Coding
3873
PDE
55729232 GRCh37
54286733 NCBI36
13201065
GCAGCATCAACTGTATCACCAGCTT C → T GTCTCTGGGTTCGCCATCTTCTCCA
+355
Phe = Phe
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3874
PDE
55729353 GRCh37
54286854 NCBI36
  
CCACCTGGGCCCCAGCCCACTGAGG C → T GGGAGCTGAGAAGCCCACCTTATTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.