UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001043
NM_001172501
NM_001172504
NM_001172502
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001043 [Chr.16(+): 55690352-55737700 GRCh37]
Id:SLC6A2_exon8
Position:Chr.16(+): 55730080-55730321 GRCh37
Chr.16(+): 54287581-54287822 NCBI36
Sequence:
TGTGCAGCTCAGACCAATGGTTTCAGCCATTGATGAGGTCCTTGATGTTTCTTACAGGAGCTGGCCTAGTGTTCATCCTG
TATCCAGAGGCCATTTCTACCCTGTCTGGATCTACATTCTGGGCTGTTGTGTTTTTCGTCATGCTCCTGGCGCTGGGCCT
TGACAGCTCA
GTGAGTGACCCTGCTTAGGATACCTATCCCCCATCCCACTGGGCCTGACCCCCTTCCCCAACACACAGTG
CT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC6A2_8_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
3875
PDE
1 pubI
55730124 GRCh37
54287625 NCBI36
  
GTTTCAGCCATTGATGAGGTCCTTG A → C TGTTTCTTACAGGAGCTGGCCTAGT
+ 
 
n=
A/A=
A/C=
C/C=
C=
200
82
15
3
0.105
200
44
44
12
0.340
60
18
11
1
0.217
20
4
5
1
0.350
14
1
5
1
0.500
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.