UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001043
NM_001172501
NM_001172504
NM_001172502
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001043 [Chr.16(+): 55690352-55737700 GRCh37]
Id:SLC6A2_exon9
Position:Chr.16(+): 55731743-55732002 GRCh37
Chr.16(+): 54289244-54289503 NCBI36
Sequence:
GGGGCCTGAGACTGAGGTCCAGGGAGACCCTAATTCCTGCACCCCACCCCTCCTGGTTCCCTCCAGATGGGAGGCATGGA
GGCTGTCATCAC
GGGCCTGGCAGATGACTTCCAGGTCCTGAAGCGACACCGGAAACTCTTCACATTTGGCGTCACCTTCA
GCACTTTCCTTCTCGCCCTGTTCTGCATAACCAAG
GTGAGTAGGGGCTGGGCTCTGGGTCACCTGGGGGCCTCTGAGGCC
GCATTTCAATAAAGTCAAAC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC6A2_9_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 9: Coding
3876
PDE
37 pubsI
55731835 GRCh37
54289336 NCBI36
15421287
TGGGAGGCATGGAGGCTGTCATCAC G → A GGCCTGGCAGATGACTTCCAGGTCC
+429
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
198
80
19
0
0.096
200
46
45
9
0.315
60
14
15
1
0.283
20
4
5
1
0.350
14
6
1
0
0.071
Set-I
 
3877
PDE
3 pubs
55731946 GRCh37
54289447 NCBI36
  
TGTTCTGCATAACCAAGGTGAGTAG G → A GGCTGGGCTCTGGGTCACCTGGGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
194
79
18
0
0.093
192
45
43
8
0.307
50
12
10
3
0.320
20
4
5
1
0.350
14
6
1
0
0.071
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.