UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001043
NM_001172501
NM_001172504
NM_001172502
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001043 [Chr.16(+): 55690352-55737700 GRCh37]
Id:SLC6A2_exon13-14
Position:Chr.16(+): 55735714-55736311 GRCh37
Chr.16(+): 54293215-54293812 NCBI36
Sequence:
AGGCTGCCAGAAGGGTGTCCCTGGGCCAAGCTGAGGCCTCCTCCCCTTCTCTTCCTTTCAGAGACTGGCCTATGGCATCA
C
GCCAGAGAACGAGCACCACCTGGTGGCTCAGAGGGACATCAGACAGTTCCAGGTGGGTGAAGCCTAGACCCCTGGGGTG
GAGATTACAAGGGCGGGCCCTGGCTGTTCCCTGCTGTGCACTGCCCAAGGCTAGACATCACATCCAGAAAACCCAGAAAC
CCAGTGTGAGCTGCCTTTTCCCCTTGGAAACATCGGGATGGGGGACAGGGAGGCTCACCTTGAGCCCATGGCCTCAGGCT
TGCCCTGTGACTTTGGGGAGGTTCTGCTGCCCTTTCTGGGCCTCTGTGACAATTAGGGAATCAACTTGCACGTTCCCTGA
GGTCCGTGAAGGAAGGGGGTGTTTTTCTGCCTTCTCTCTACCTCCTGCTGCCCCCGCCAGCTGGCCCTTGCTCCTTTCTG
TCCCCACCATGTCATCAAGTCCTCGCTGTCTTTCTCTGCAGTTGCAACACTGGCTGGCCATCTGAGCCTGCCTGGAGGAG
AAGGAGGAACCCCCATGCCAATGTCCAGGTCACAGGCA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC6A2_13-14_DHPLC
SLC6A2_13-14_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 13: Coding
3879
PDE
55735795 GRCh37
54293296 NCBI36
20341779
TTCAGAGACTGGCCTATGGCATCAC G → A CCAGAGAACGAGCACCACCTGGTGG
+593
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
198
98
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3880
PDE
55735887 GRCh37
54293388 NCBI36
  
ACCCCTGGGGTGGAGATTACAAGGG C → T GGGCCCTGGCTGTTCCCTGCTGTGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3881
PDE
3 pubsI
55735912 GRCh37
54293413 NCBI36
  
CGGGCCCTGGCTGTTCCCTGCTGTG C → T ACTGCCCAAGGCTAGACATCACATC
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
89
9
2
0.065
200
76
17
7
0.155
60
25
2
3
0.133
20
6
1
3
0.350
14
6
1
0
0.071
Set-I
 
3882
PDE
55735998 GRCh37
54293499 NCBI36
  
CCCCTTGGAAACATCGGGATGGGGG A → - CAGGGAGGCTCACCTTGAGCCCATG
+ 
 
n=
A/A=
A/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3883
PDE
55735999 GRCh37
54293500 NCBI36
  
CCCTTGGAAACATCGGGATGGGGGA C → - AGGGAGGCTCACCTTGAGCCCATGG
+ 
 
n=
C/C=
C/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3884
PDE
55736000 GRCh37
54293501 NCBI36
  
CCTTGGAAACATCGGGATGGGGGAC A → - GGGAGGCTCACCTTGAGCCCATGGC
+ 
 
n=
A/A=
A/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3885
PDE
55736001 GRCh37
54293502 NCBI36
  
CTTGGAAACATCGGGATGGGGGACA G → - GGAGGCTCACCTTGAGCCCATGGCC
+ 
 
n=
G/G=
G/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3886
PDE
55736002 GRCh37
54293503 NCBI36
  
TTGGAAACATCGGGATGGGGGACAG G → - GAGGCTCACCTTGAGCCCATGGCCT
+ 
 
n=
G/G=
G/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3887
PDE
55736003 GRCh37
54293504 NCBI36
  
TGGAAACATCGGGATGGGGGACAGG G → - AGGCTCACCTTGAGCCCATGGCCTC
+ 
 
n=
G/G=
G/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3888
PDE
55736099 GRCh37
54293600 NCBI36
  
CCTCTGTGACAATTAGGGAATCAAC T → G TGCACGTTCCCTGAGGTCCGTGAAG
+ 
 
n=
T/T=
T/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3889
PDE
55736149 GRCh37
54293650 NCBI36
  
GGAAGGGGGTGTTTTTCTGCCTTCT C → G TCTACCTCCTGCTGCCCCCGCCAGC
+ 
 
n=
C/C=
C/G=
G/G=
G=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.