UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2_exon5
Position:Chr.3(+): 121631804-121632037 GRCh37
Chr.3(+): 123114494-123114727 NCBI36
Sequence:
GTAGTCCATCTCTACAGGTGCATTTAGTATCAACATGGTTGGCATTCTCACCTCTCCATTTCAGAGTCCTATCATTGATC
GGCCTGAGTCTAATAGCTTTGGGGACAGGAGGCATCAAACCCTGTGTGGCAGCTTTTGGTGGAGACCAGTTTGAAGAAAA
ACAT
GTAAGAATCCTGTTATTTTGTATTTTCAAGAATATAGAGCCAGCATTAATGGGGGTATCTGGCAGGTAGC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC15A2_5_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4062
PDE
IA
121631841 GRCh37
123114531 NCBI36
  
TACAGGTGCATTTAGTATCAACATG G → A TTGGCATTCTCACCTCTCCATTTCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
196
72
23
3
0.148
198
44
46
9
0.323
60
20
7
3
0.217
20
6
2
2
0.300
14
0
5
2
0.643
Set-I
 
4063
PDE
121631993 GRCh37
123114683 NCBI36
  
GTAAGAATCCTGTTATTTTGTATTT T → G CAAGAATATAGAGCCAGCATTAATG
+ 
 
n=
T/T=
T/G=
G/G=
G=
198
98
1
0
0.005
198
92
7
0
0.035
60
27
3
0
0.050
20
6
3
1
0.250
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.