UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2_exon13
Position:Chr.3(+): 121643720-121643939 GRCh37
Chr.3(+): 123126410-123126629 NCBI36
Sequence:
CAAATGAGTGCAGTGCTCACACTCATGATAGGAGAATATTTGTAGCTAATCCTTTTTATCATGGTGTTACAGGTTCTAAA
TCCC
TTTCTGGTTCTTATCTTCATCCCGTTGTTTGACTTTGTCATTTATCGTCTGGTCTCCAAGTGTGGAATTAACTTCT
C
GTAAGTGTTCACCATGTCTGTATGGATTACTCTAAATTGACTCAGTCTTTGCCCAGTTT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC15A2_13_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4065
PDE
121643752 GRCh37
123126442 NCBI36
  
GTGCAGTGCTCACACTCATGATAGG A → G GAATATTTGTAGCTAATCCTTTTTA
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
91
9
0
0.045
198
97
2
0
0.010
50
25
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 13: Coding
4066
PDE
2 pubsI
121643804 GRCh37
123126494 NCBI36
12011048
CATGGTGTTACAGGTTCTAAATCCC T → C TTCTGGTTCTTATCTTCATCCCGTT
PEPT2*1 (350L-409P-509R) showed lower Km for glycyl-sarcosine compared to PEPT2*2 (350F-409S-509K) in transfected cells. PMID: 19940846.
+350
Phe → Leu
(D=22)
n=
T/T=
T/C=
C/C=
C=
200
24
57
19
0.475
198
16
62
21
0.525
56
11
13
4
0.375
20
3
1
6
0.650
14
0
4
3
0.714
Set-I
 
4067
PDE
I
121643893 GRCh37
123126583 NCBI36
  
GAATTAACTTCTCGTAAGTGTTCAC C → T ATGTCTGTATGGATTACTCTAAATT
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
24
56
20
0.480
196
17
60
21
0.520
56
11
13
4
0.375
20
3
1
6
0.650
14
0
4
3
0.714
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.