UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2_exon14
Position:Chr.3(+): 121646542-121646760 GRCh37
Chr.3(+): 123129232-123129450 NCBI36
Sequence:
AGTTTGGATTTCATCCTTTAGAGTCTAAAGTTTAGATATAATTGTTTCTCCTTTCCACCACAGATCACTTAGGAAAATGG
CTGTTGGTATGATCCTAGC
GTGCCTGGCATTTGCAGTTGCGGCAGCTGTAGAGATAAAAATAAATGTGAGTTCAGTAATT
CTTAAGCTCTATGAGGGCAGGATCATATCTTTCTTATTTGCTCTTTTGACTTGTTCAAT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC15A2_14_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 14: Coding
4068
PDE
1 pubI
121646641 GRCh37
123129331 NCBI36
13141161
AAATGGCTGTTGGTATGATCCTAGC G → A TGCCTGGCATTTGCAGTTGCGGCAG
+387
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
196
21
55
22
0.505
194
23
50
24
0.505
60
11
15
4
0.383
20
3
0
7
0.700
14
0
4
3
0.714
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.