UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2_exon15
Position:Chr.3(+): 121647199-121647464 GRCh37
Chr.3(+): 123129889-123130154 NCBI36
Sequence:
AGATATGTGTTGCCATTGTATCTGAAGGATTATTTGTTGGTGATTCTGACATGTGTTCTTTGCTCTAAGGAAATGGCCCC
AGCCCAG
TCAGGTCCCCAGGAGGTTTTCCTACAAGTCTTGAATCTGGCAGATGATGAGGTGAAGGTGACAGTGGTGGGAA
ATGAAAACAATTCTCTGTTGATAGAGTCCATCAAATCCTTTCAG
GTGAGGTGTGTACCTGAATGAATTAGAAACTCTGTA
TGCTATATTGATCTTGATTTTTCCTT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC15A2_15_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 15: Coding
4069
PDE
4 pubsI
121647286 GRCh37
123129976 NCBI36
13781225
CTCTAAGGAAATGGCCCCAGCCCAG T → C CAGGTCCCCAGGAGGTTTTCCTACA
PEPT2*1 (350L-409P-509R) showed lower Km for glycyl-sarcosine compared to PEPT2*2 (350F-409S-509K) in transfected cells. PMID: 19940846.
+409
Ser → Pro
(D=74)
n=
T/T=
T/C=
C/C=
C=
198
27
52
20
0.465
198
23
51
25
0.510
60
12
14
4
0.367
20
3
0
7
0.700
14
0
4
3
0.714
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.